ID: 947718172 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:232352149-232352171 |
| Sequence | CCAGCCCGCGCCCCGCGAGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947718172_947718179 | -9 | Left | 947718172 | 2:232352149-232352171 | CCCCCTCGCGGGGCGCGGGCTGG | No data | ||
| Right | 947718179 | 2:232352163-232352185 | GCGGGCTGGCCGGGTGCGCCCGG | No data | ||||
| 947718172_947718180 | -1 | Left | 947718172 | 2:232352149-232352171 | CCCCCTCGCGGGGCGCGGGCTGG | No data | ||
| Right | 947718180 | 2:232352171-232352193 | GCCGGGTGCGCCCGGAGTCCTGG | No data | ||||
| 947718172_947718185 | 21 | Left | 947718172 | 2:232352149-232352171 | CCCCCTCGCGGGGCGCGGGCTGG | No data | ||
| Right | 947718185 | 2:232352193-232352215 | GAGCCGCGCCGCTCAGTCCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947718172 | Original CRISPR | CCAGCCCGCGCCCCGCGAGG GGG (reversed) | Intergenic | ||