ID: 947718174

View in Genome Browser
Species Human (GRCh38)
Location 2:232352150-232352172
Sequence GCCAGCCCGCGCCCCGCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947718174_947718179 -10 Left 947718174 2:232352150-232352172 CCCCTCGCGGGGCGCGGGCTGGC No data
Right 947718179 2:232352163-232352185 GCGGGCTGGCCGGGTGCGCCCGG No data
947718174_947718185 20 Left 947718174 2:232352150-232352172 CCCCTCGCGGGGCGCGGGCTGGC No data
Right 947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG No data
947718174_947718180 -2 Left 947718174 2:232352150-232352172 CCCCTCGCGGGGCGCGGGCTGGC No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947718174 Original CRISPR GCCAGCCCGCGCCCCGCGAG GGG (reversed) Intergenic
No off target data available for this crispr