ID: 947718175 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:232352151-232352173 |
Sequence | GGCCAGCCCGCGCCCCGCGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
947718175_947718185 | 19 | Left | 947718175 | 2:232352151-232352173 | CCCTCGCGGGGCGCGGGCTGGCC | No data | ||
Right | 947718185 | 2:232352193-232352215 | GAGCCGCGCCGCTCAGTCCGTGG | No data | ||||
947718175_947718180 | -3 | Left | 947718175 | 2:232352151-232352173 | CCCTCGCGGGGCGCGGGCTGGCC | No data | ||
Right | 947718180 | 2:232352171-232352193 | GCCGGGTGCGCCCGGAGTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
947718175 | Original CRISPR | GGCCAGCCCGCGCCCCGCGA GGG (reversed) | Intergenic | ||