ID: 947718175

View in Genome Browser
Species Human (GRCh38)
Location 2:232352151-232352173
Sequence GGCCAGCCCGCGCCCCGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947718175_947718185 19 Left 947718175 2:232352151-232352173 CCCTCGCGGGGCGCGGGCTGGCC No data
Right 947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG No data
947718175_947718180 -3 Left 947718175 2:232352151-232352173 CCCTCGCGGGGCGCGGGCTGGCC No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947718175 Original CRISPR GGCCAGCCCGCGCCCCGCGA GGG (reversed) Intergenic
No off target data available for this crispr