ID: 947718176 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:232352152-232352174 |
Sequence | CGGCCAGCCCGCGCCCCGCG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
947718176_947718185 | 18 | Left | 947718176 | 2:232352152-232352174 | CCTCGCGGGGCGCGGGCTGGCCG | No data | ||
Right | 947718185 | 2:232352193-232352215 | GAGCCGCGCCGCTCAGTCCGTGG | No data | ||||
947718176_947718180 | -4 | Left | 947718176 | 2:232352152-232352174 | CCTCGCGGGGCGCGGGCTGGCCG | No data | ||
Right | 947718180 | 2:232352171-232352193 | GCCGGGTGCGCCCGGAGTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
947718176 | Original CRISPR | CGGCCAGCCCGCGCCCCGCG AGG (reversed) | Intergenic | ||