ID: 947718176

View in Genome Browser
Species Human (GRCh38)
Location 2:232352152-232352174
Sequence CGGCCAGCCCGCGCCCCGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947718176_947718180 -4 Left 947718176 2:232352152-232352174 CCTCGCGGGGCGCGGGCTGGCCG No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data
947718176_947718185 18 Left 947718176 2:232352152-232352174 CCTCGCGGGGCGCGGGCTGGCCG No data
Right 947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947718176 Original CRISPR CGGCCAGCCCGCGCCCCGCG AGG (reversed) Intergenic