ID: 947718180

View in Genome Browser
Species Human (GRCh38)
Location 2:232352171-232352193
Sequence GCCGGGTGCGCCCGGAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947718172_947718180 -1 Left 947718172 2:232352149-232352171 CCCCCTCGCGGGGCGCGGGCTGG No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data
947718162_947718180 29 Left 947718162 2:232352119-232352141 CCCCAGAACCCAAACTTGGGTGA No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data
947718174_947718180 -2 Left 947718174 2:232352150-232352172 CCCCTCGCGGGGCGCGGGCTGGC No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data
947718175_947718180 -3 Left 947718175 2:232352151-232352173 CCCTCGCGGGGCGCGGGCTGGCC No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data
947718163_947718180 28 Left 947718163 2:232352120-232352142 CCCAGAACCCAAACTTGGGTGAA No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data
947718176_947718180 -4 Left 947718176 2:232352152-232352174 CCTCGCGGGGCGCGGGCTGGCCG No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data
947718166_947718180 20 Left 947718166 2:232352128-232352150 CCAAACTTGGGTGAAGTTTCACC No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data
947718164_947718180 27 Left 947718164 2:232352121-232352143 CCAGAACCCAAACTTGGGTGAAG No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data
947718165_947718180 21 Left 947718165 2:232352127-232352149 CCCAAACTTGGGTGAAGTTTCAC No data
Right 947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947718180 Original CRISPR GCCGGGTGCGCCCGGAGTCC TGG Intergenic