ID: 947718181

View in Genome Browser
Species Human (GRCh38)
Location 2:232352172-232352194
Sequence TCCAGGACTCCGGGCGCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947718181_947718189 18 Left 947718181 2:232352172-232352194 CCGGGTGCGCCCGGAGTCCTGGA No data
Right 947718189 2:232352213-232352235 TGGAGCCCGAGAGCGAAGCCTGG No data
947718181_947718185 -2 Left 947718181 2:232352172-232352194 CCGGGTGCGCCCGGAGTCCTGGA No data
Right 947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG No data
947718181_947718190 19 Left 947718181 2:232352172-232352194 CCGGGTGCGCCCGGAGTCCTGGA No data
Right 947718190 2:232352214-232352236 GGAGCCCGAGAGCGAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947718181 Original CRISPR TCCAGGACTCCGGGCGCACC CGG (reversed) Intergenic
No off target data available for this crispr