ID: 947718185

View in Genome Browser
Species Human (GRCh38)
Location 2:232352193-232352215
Sequence GAGCCGCGCCGCTCAGTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947718176_947718185 18 Left 947718176 2:232352152-232352174 CCTCGCGGGGCGCGGGCTGGCCG No data
Right 947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG No data
947718174_947718185 20 Left 947718174 2:232352150-232352172 CCCCTCGCGGGGCGCGGGCTGGC No data
Right 947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG No data
947718175_947718185 19 Left 947718175 2:232352151-232352173 CCCTCGCGGGGCGCGGGCTGGCC No data
Right 947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG No data
947718181_947718185 -2 Left 947718181 2:232352172-232352194 CCGGGTGCGCCCGGAGTCCTGGA No data
Right 947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG No data
947718172_947718185 21 Left 947718172 2:232352149-232352171 CCCCCTCGCGGGGCGCGGGCTGG No data
Right 947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947718185 Original CRISPR GAGCCGCGCCGCTCAGTCCG TGG Intergenic
No off target data available for this crispr