ID: 947721254

View in Genome Browser
Species Human (GRCh38)
Location 2:232370394-232370416
Sequence TCCTGGAGCCAAGTATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947721245_947721254 6 Left 947721245 2:232370365-232370387 CCCCATCTGTTCCTGTCCCCAGA No data
Right 947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG No data
947721243_947721254 22 Left 947721243 2:232370349-232370371 CCAGAGGCCACGGTCACCCCATC No data
Right 947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG No data
947721248_947721254 -5 Left 947721248 2:232370376-232370398 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG No data
947721246_947721254 5 Left 947721246 2:232370366-232370388 CCCATCTGTTCCTGTCCCCAGAA No data
Right 947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG No data
947721244_947721254 15 Left 947721244 2:232370356-232370378 CCACGGTCACCCCATCTGTTCCT No data
Right 947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG No data
947721242_947721254 23 Left 947721242 2:232370348-232370370 CCCAGAGGCCACGGTCACCCCAT No data
Right 947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG No data
947721247_947721254 4 Left 947721247 2:232370367-232370389 CCATCTGTTCCTGTCCCCAGAAC No data
Right 947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG No data
947721250_947721254 -10 Left 947721250 2:232370381-232370403 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947721254 Original CRISPR TCCTGGAGCCAAGTATCTGC AGG Intergenic
No off target data available for this crispr