ID: 947721774

View in Genome Browser
Species Human (GRCh38)
Location 2:232374101-232374123
Sequence CCCTGTGGCCCTTGGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947721774_947721785 -4 Left 947721774 2:232374101-232374123 CCCCAAGACCAAGGGCCACAGGG No data
Right 947721785 2:232374120-232374142 AGGGGAGGGGTGACCTCAAAGGG No data
947721774_947721786 5 Left 947721774 2:232374101-232374123 CCCCAAGACCAAGGGCCACAGGG No data
Right 947721786 2:232374129-232374151 GTGACCTCAAAGGGATGTGTAGG No data
947721774_947721784 -5 Left 947721774 2:232374101-232374123 CCCCAAGACCAAGGGCCACAGGG No data
Right 947721784 2:232374119-232374141 CAGGGGAGGGGTGACCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947721774 Original CRISPR CCCTGTGGCCCTTGGTCTTG GGG (reversed) Intergenic
No off target data available for this crispr