ID: 947722757

View in Genome Browser
Species Human (GRCh38)
Location 2:232379613-232379635
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 3, 1: 0, 2: 0, 3: 2, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947722757_947722762 -4 Left 947722757 2:232379613-232379635 CCGCCCGCTTTAACCAGTGCAAC 0: 3
1: 0
2: 0
3: 2
4: 54
Right 947722762 2:232379632-232379654 CAACACGACACGCGGCAACGAGG 0: 2
1: 1
2: 0
3: 0
4: 9
947722757_947722766 30 Left 947722757 2:232379613-232379635 CCGCCCGCTTTAACCAGTGCAAC 0: 3
1: 0
2: 0
3: 2
4: 54
Right 947722766 2:232379666-232379688 ATGAATCGGGCCAAGAAAGCAGG 0: 2
1: 0
2: 1
3: 5
4: 85
947722757_947722763 16 Left 947722757 2:232379613-232379635 CCGCCCGCTTTAACCAGTGCAAC 0: 3
1: 0
2: 0
3: 2
4: 54
Right 947722763 2:232379652-232379674 AGGTCATCTCCGTGATGAATCGG 0: 2
1: 1
2: 1
3: 8
4: 97
947722757_947722764 17 Left 947722757 2:232379613-232379635 CCGCCCGCTTTAACCAGTGCAAC 0: 3
1: 0
2: 0
3: 2
4: 54
Right 947722764 2:232379653-232379675 GGTCATCTCCGTGATGAATCGGG 0: 2
1: 1
2: 0
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947722757 Original CRISPR GTTGCACTGGTTAAAGCGGG CGG (reversed) Exonic
901564976 1:10106525-10106547 GTGGCACTGGGTGAGGCGGGTGG - Exonic
903550631 1:24155536-24155558 GCTGCTCTGGTGAAAGTGGGAGG + Exonic
904940721 1:34163868-34163890 GGTGCTGTGGGTAAAGCGGGAGG + Intronic
919924505 1:202185439-202185461 GTGGGACTGGGTAAAGCAGGGGG + Intergenic
923231615 1:231991551-231991573 CTTGCACTGATCAAAACGGGGGG + Intronic
1064350851 10:14575105-14575127 CTTGCACTGAATAAAGCAGGTGG + Intronic
1064436076 10:15312449-15312471 CTTGCTCTGGTTAAAGCCAGTGG + Intronic
1069632869 10:69908065-69908087 GTTGCACTCCTTACAGCAGGTGG - Intronic
1073457764 10:103647887-103647909 GAGGCACTGGTTAAGGCAGGGGG + Intronic
1075836134 10:125454460-125454482 GTAGCACTGCTCAGAGCGGGAGG - Intergenic
1076614753 10:131748043-131748065 GTTGAAGGGGCTAAAGCGGGAGG - Intergenic
1076893314 10:133295835-133295857 GTGGCACTGGTCAAATCGTGGGG + Intronic
1083331569 11:61900771-61900793 GCTGCACTGGATGAAGCTGGGGG - Intronic
1086641117 11:89156696-89156718 GTACCACTGGTAAAAGAGGGAGG - Intergenic
1096460162 12:51818033-51818055 GTAGAAATGGTTACAGCGGGAGG + Intergenic
1115768472 14:36647299-36647321 GTCGGGCTGGTTAAGGCGGGAGG - Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118726945 14:68635279-68635301 GTTGCCCAGGTTGAAGGGGGTGG - Intronic
1124125860 15:26937657-26937679 TCTGCACTGTTTAAAGCAGGAGG - Intronic
1127002901 15:54531005-54531027 ATTGCACAGGTTCAAGTGGGAGG + Intronic
1129707215 15:77801648-77801670 GCTGCTCTGGCTAAAGGGGGAGG + Intronic
1131874183 15:96787225-96787247 GTTGGACTGGGCAAAGCCGGTGG - Intergenic
1137901141 16:52270814-52270836 GTTGCACAGGCTAAGGCGGAGGG - Intergenic
1141146955 16:81537788-81537810 GTTTCCCTGCTCAAAGCGGGAGG - Intronic
1148351392 17:46944257-46944279 TTTGCACTGGTTACAGCGGCCGG + Intronic
1152909003 17:82986455-82986477 GTACCAGTGGTTAAAGCGTGGGG - Intronic
1158267839 18:55679581-55679603 GTTGCTCTGGTTGAACCTGGTGG + Intergenic
1168621693 19:57884415-57884437 GTCTCACTGGTTAAACAGGGTGG - Intronic
925532384 2:4878170-4878192 GTGGCACTCTTTAAAGCGTGTGG + Intergenic
938563300 2:132494194-132494216 GTTTCACTGGCTAAACCAGGGGG + Intronic
939432473 2:142129777-142129799 GATGCACTGGTGAAAAAGGGAGG - Intronic
940402826 2:153267141-153267163 ATTGCACTGGTTTAAGAGGTGGG + Intergenic
942578918 2:177395370-177395392 GTTGCATAGGTTACAGCTGGTGG + Intronic
947722757 2:232379613-232379635 GTTGCACTGGTTAAAGCGGGCGG - Exonic
947727096 2:232407694-232407716 GTTGCACTGGTTAAAGCGGGCGG - Exonic
947736258 2:232456999-232457021 GTTGCACTGGTTAAAGCGGGCGG - Exonic
1174091579 20:48053005-48053027 GTTGCTCTGGTTGAAACTGGGGG + Intergenic
1177637348 21:23804439-23804461 ATTGCTCTGGTTAAAGTGTGTGG + Intergenic
1181494474 22:23280244-23280266 GTTGCACTGGCAACAGCTGGAGG + Intronic
1182686233 22:32123062-32123084 GTTGCACTGCTTGCAGTGGGGGG + Intergenic
952637066 3:35545408-35545430 TTTACACTGGTAAAAGAGGGAGG + Intergenic
953153069 3:40342976-40342998 GTTGCACTGGTGACACTGGGGGG + Intergenic
959686216 3:109149899-109149921 GTTTTCCTGGTTAAAGCAGGAGG + Intergenic
963001134 3:140682878-140682900 GTTGCACAGGTTGAGGCGGCAGG - Exonic
963267641 3:143254900-143254922 GCTACACAGGTTAACGCGGGAGG + Intergenic
963720849 3:148860321-148860343 GATGCACTGATTATAGTGGGAGG + Intergenic
980190918 4:129523917-129523939 GTGGCACTGGTTAAAGAGCTAGG + Intergenic
988977152 5:36526816-36526838 GTTTCACAGCTTAAAGGGGGTGG - Intergenic
998576327 5:143321461-143321483 ATTGCAGTGGTTAAAGCAAGAGG - Intronic
1011951947 6:92977949-92977971 GGTGAACTGGTTAAAGGAGGAGG - Intergenic
1012864932 6:104607575-104607597 ATTGCTCTGGTTAATGTGGGTGG - Intergenic
1021480779 7:21113876-21113898 GTTGTGCTGGTTGAAGCAGGAGG - Intergenic
1025739379 7:64183376-64183398 GGTGCCCTGGTTGAGGCGGGCGG - Intronic
1033405770 7:141071177-141071199 GGTGCACTGGTTAAGGGGGGTGG + Intergenic
1035134037 7:156683087-156683109 GTTAAACTGGTAAAAGCTGGAGG + Exonic
1039991656 8:42493148-42493170 GTGGCACTGTATAAAGCAGGTGG + Intronic
1040567602 8:48581815-48581837 GTTGCACTTCATAAAGCGGTTGG + Intergenic
1041132890 8:54721724-54721746 CTTGCCCTTGTTAAAGCAGGAGG - Intergenic
1047022259 8:120786853-120786875 CTGGCAGTGGCTAAAGCGGGTGG - Intronic