ID: 947729642

View in Genome Browser
Species Human (GRCh38)
Location 2:232420828-232420850
Sequence AGGCTCCGGCGCGCACCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947729642_947729651 -1 Left 947729642 2:232420828-232420850 CCGGCAGGTGCGCGCCGGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 95
Right 947729651 2:232420850-232420872 TGGCAGAGGCGGAGCGGGTCGGG 0: 1
1: 0
2: 1
3: 25
4: 281
947729642_947729650 -2 Left 947729642 2:232420828-232420850 CCGGCAGGTGCGCGCCGGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 95
Right 947729650 2:232420849-232420871 CTGGCAGAGGCGGAGCGGGTCGG 0: 1
1: 0
2: 0
3: 27
4: 317
947729642_947729652 21 Left 947729642 2:232420828-232420850 CCGGCAGGTGCGCGCCGGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 95
Right 947729652 2:232420872-232420894 GCCGAAGCCGCTGCCTGAGCAGG 0: 1
1: 1
2: 0
3: 12
4: 195
947729642_947729648 -6 Left 947729642 2:232420828-232420850 CCGGCAGGTGCGCGCCGGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 95
Right 947729648 2:232420845-232420867 GAGCCTGGCAGAGGCGGAGCGGG 0: 1
1: 1
2: 7
3: 57
4: 536
947729642_947729647 -7 Left 947729642 2:232420828-232420850 CCGGCAGGTGCGCGCCGGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 95
Right 947729647 2:232420844-232420866 GGAGCCTGGCAGAGGCGGAGCGG 0: 1
1: 0
2: 3
3: 61
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947729642 Original CRISPR AGGCTCCGGCGCGCACCTGC CGG (reversed) Intergenic
900178275 1:1300218-1300240 AGCCTCCGGGGCTCACCTGTGGG - Intronic
900474597 1:2870210-2870232 AGGCTCCTGCCCTCACTTGCTGG + Intergenic
902525367 1:17053932-17053954 AGGCTCCAGGACTCACCTGCAGG + Exonic
903231819 1:21926978-21927000 CGGCTCCGGCCCCCACCTCCTGG - Intronic
908258200 1:62319307-62319329 TGGCCCCGGCGCACCCCTGCGGG + Exonic
913186201 1:116372994-116373016 GGGCTGCGGGGCGCTCCTGCTGG - Intronic
915440501 1:155942662-155942684 AGGCTCTGGCAGGCACCTTCAGG + Exonic
920704777 1:208243320-208243342 CGCCTCCACCGCGCACCTGCCGG - Intronic
922711658 1:227838444-227838466 AGGCTCCAGAGCGCCCATGCTGG - Intronic
922744923 1:228038274-228038296 CGGCTCCGGCGGGCTCCGGCGGG + Intronic
924242840 1:242057164-242057186 AGGGTCCAGCGCGGACCTGCCGG + Intergenic
1070596022 10:77833889-77833911 AGGCTCGGGTGGGCACCCGCTGG - Intronic
1071570731 10:86695414-86695436 AGGCTCCAGTGCCAACCTGCTGG + Intronic
1072187982 10:93060544-93060566 AAGCTCTGGCGCGAACCCGCAGG + Intergenic
1073432196 10:103494013-103494035 CGGCTCCGGCGCGCTCCCCCGGG - Exonic
1076661465 10:132058441-132058463 AGGCTCCTCCTCCCACCTGCAGG - Intergenic
1076891792 10:133288343-133288365 TGGCTGTGGCGGGCACCTGCGGG - Intronic
1076891804 10:133288391-133288413 TGGCTGTGGCGGGCACCTGCGGG - Intronic
1077281618 11:1748629-1748651 AGACCCCGGGGCGCACCCGCGGG + Intronic
1102025825 12:109713968-109713990 AGGCGCCGGCGCGCGCCAGACGG + Intergenic
1103139685 12:118537546-118537568 AGGCTCCTGCGGGCTCCTGTGGG - Intergenic
1103516839 12:121513733-121513755 AGGCAGCGGCTCCCACCTGCAGG - Intronic
1104020497 12:124988962-124988984 AGGGTCCGGGGCCCGCCTGCTGG + Exonic
1104716362 12:131018912-131018934 GGGCTCCTGCCCCCACCTGCAGG - Intronic
1104748953 12:131226531-131226553 ACGCTCCAGGGCGCCCCTGCAGG - Intergenic
1104784172 12:131439033-131439055 ACGCTCCAGGGCGCCCCTGCAGG + Intergenic
1108220934 13:48233049-48233071 GGGATCCGGCGCCCAGCTGCGGG + Intergenic
1113755280 13:112807176-112807198 TGGCTCCGCCACGCTCCTGCCGG - Intronic
1113926507 13:113944551-113944573 AGGGTCCAGCACACACCTGCAGG - Intergenic
1117272029 14:54154499-54154521 AGGCTCCGGGGTGCATGTGCAGG + Intergenic
1125694175 15:41621583-41621605 AGGCGCCTGCGCATACCTGCCGG - Intronic
1136402561 16:30026535-30026557 AGGCTCCTGCCAGCACCAGCAGG + Intronic
1141949155 16:87329673-87329695 AGACCCCGAGGCGCACCTGCTGG - Exonic
1142299619 16:89248685-89248707 AGGCTGCGGCCGGCACCTCCCGG - Intergenic
1142509636 17:385748-385770 CCGCCCCGGCGCGCACGTGCGGG - Intronic
1142600219 17:1050238-1050260 AAGCTGAGGCACGCACCTGCCGG - Intronic
1143519173 17:7435955-7435977 CTGCTCCGGGGCGCAGCTGCAGG + Exonic
1147705391 17:42422111-42422133 GGGCTCAGGCACGCACCAGCGGG - Intronic
1150003741 17:61457041-61457063 CGGCTCCCGTGCGCACCGGCGGG - Intronic
1152218862 17:79049901-79049923 AGGGTCCAGCATGCACCTGCTGG - Intergenic
1152558586 17:81066842-81066864 AGGCTGCGGCCTCCACCTGCAGG - Intronic
1152718456 17:81911112-81911134 AGGCTGCGGGGCTCGCCTGCCGG - Intronic
1154241389 18:12657380-12657402 AGGATCCGGCGGGGACCCGCAGG - Intronic
1155054615 18:22172227-22172249 GGGCTCCGGCGCGGCTCTGCAGG - Exonic
1160789933 19:918662-918684 CTGCTCCGGAGCGCACCTGCTGG - Exonic
1161237535 19:3205289-3205311 AGGAGACGGCGCCCACCTGCTGG - Intronic
1163770122 19:19186018-19186040 AGGCTGTGGCGCTCACCTGCAGG + Exonic
1167258305 19:48443680-48443702 AGGCACCGGCGCGCCGCTGGGGG + Exonic
925068982 2:951203-951225 GGGCTCCGGCGCCCACCCTCCGG - Intronic
925201011 2:1967857-1967879 AGGCTCCTGCCCTCCCCTGCAGG - Intronic
932887471 2:75560688-75560710 GGGCCCCGGCGCGCACTTCCGGG + Intronic
940346109 2:152630783-152630805 AGGCACCTGCATGCACCTGCTGG + Intronic
947729642 2:232420828-232420850 AGGCTCCGGCGCGCACCTGCCGG - Intergenic
947741697 2:232487719-232487741 CGGCTCGGGCGCGCACCTGCCGG - Exonic
948206956 2:236167579-236167601 CGGCTGCGGCGCGAACTTGCGGG + Exonic
948818501 2:240526189-240526211 AAGCTCCTGCGGGCACCAGCTGG + Intronic
948862134 2:240757805-240757827 AGGTTCCGGAGGACACCTGCAGG + Intronic
1176181539 20:63751886-63751908 AGGTTCCGGAGCGGACCTGCAGG - Intronic
1176549462 21:8214916-8214938 AGACGCCGGCGCGCCCCCGCGGG - Intergenic
1176557357 21:8259145-8259167 AGACGCCGGCGCGCCCCCGCGGG - Intergenic
1176568390 21:8397950-8397972 AGACGCCGGCGCGCCCCCGCGGG - Intergenic
1176576299 21:8442180-8442202 AGACGCCGGCGCGCCCCCGCGGG - Intergenic
1178680834 21:34670593-34670615 AGGCTCCGCGGCGCCCCTGGAGG - Exonic
1180000196 21:44992134-44992156 AGGCCACAGCGGGCACCTGCAGG + Intergenic
1184274902 22:43404631-43404653 AGGCTGGGGCAGGCACCTGCTGG + Intergenic
1184502984 22:44885209-44885231 AGGCCCCGGTGCACACCTGCAGG + Intronic
1185029611 22:48434774-48434796 GGGCTGTGGGGCGCACCTGCTGG - Intergenic
1203254349 22_KI270733v1_random:131238-131260 AGACGCCGGCGCGCCCCCGCGGG - Intergenic
1203262405 22_KI270733v1_random:176317-176339 AGACGCCGGCGCGCCCCCGCGGG - Intergenic
949540189 3:5026601-5026623 AAGCGCCGGCTCGCGCCTGCAGG + Intergenic
954107617 3:48417873-48417895 AGGCTGCGCCGTGCTCCTGCTGG + Intronic
954467994 3:50668308-50668330 AGGCTCCAGCGCTCATCTCCCGG - Intergenic
964786299 3:160399922-160399944 GGGCTCCCGCGCGCAGCTCCCGG + Intronic
968427692 4:534400-534422 AGGGTCCTGCGCGCTCCAGCAGG - Intronic
968820031 4:2843589-2843611 AGACTGCGGCGAGCCCCTGCCGG - Intergenic
968830607 4:2931465-2931487 AGGCTGCCGTGCCCACCTGCAGG - Exonic
970967888 4:21948888-21948910 AGCCGCCGGCGCGAAGCTGCCGG - Intergenic
978384907 4:108168896-108168918 AGGCGCAGCCGCTCACCTGCGGG - Intronic
986402828 5:7396164-7396186 AGGCCCCTGCGCGCAGCTCCGGG + Intergenic
986747932 5:10760822-10760844 AAGCTCCGGCGGGCTCCTCCCGG + Intronic
992690390 5:79236027-79236049 AGGCGCCGGCGCGCGCGGGCGGG + Intronic
995047893 5:107671056-107671078 CGGCTGCGGCGCGCAACTCCCGG - Intergenic
1001447110 5:171794176-171794198 TGGCTCCAGCGCCCAGCTGCAGG + Intronic
1002041847 5:176520507-176520529 GGGCTCCAGTGCACACCTGCAGG - Intergenic
1003131200 6:3396679-3396701 AGGCACCGGCATGCACCAGCAGG + Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1014150020 6:118044069-118044091 AGGCACTGGCCTGCACCTGCAGG - Intronic
1023937370 7:44749179-44749201 AGGCTCTGCCGCCCACCTGCCGG + Intronic
1027361800 7:77416597-77416619 AGGCCTCCGCGCGCACCTTCGGG + Intergenic
1029214163 7:98933499-98933521 AGGCTCGGGCGGGGACCTGCAGG + Intronic
1029569979 7:101362966-101362988 GGGCGCCGGTGCGCTCCTGCCGG + Exonic
1031887154 7:127254088-127254110 AGGCGGCCGCGCGCAACTGCAGG + Intergenic
1031990151 7:128192416-128192438 AAGCTGCTGCGCGCAGCTGCTGG - Intergenic
1039565869 8:38552360-38552382 AGGCTCCAGCCCTCACCAGCAGG - Intergenic
1046962349 8:120124881-120124903 CGGCTGCCGCGCGCACCTGGGGG + Intronic
1049268108 8:141680362-141680384 AGGCTCAGGCTGGCATCTGCAGG + Intergenic
1049797183 8:144502224-144502246 ATGCCCCAGCGCGCACCTACAGG - Intergenic
1060599561 9:124869083-124869105 AGGCTCCGCCCCGCCCCTGACGG + Exonic
1060985716 9:127818004-127818026 AGGCTCCGCCCCTCACCAGCTGG + Intronic
1061828462 9:133275618-133275640 AGGCTGCGGCGCGCGCGAGCCGG - Intergenic
1203470750 Un_GL000220v1:114382-114404 AGACGCCGGCGCGCCCCCGCGGG - Intergenic
1203478571 Un_GL000220v1:158354-158376 AGACGCCGGCGCGCCCCCGCGGG - Intergenic
1192677608 X:73214738-73214760 AGTCTCCGGCTCTCTCCTGCAGG - Exonic