ID: 947731299

View in Genome Browser
Species Human (GRCh38)
Location 2:232433054-232433076
Sequence CAGGGGAAAGGCTCTGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731293_947731299 -3 Left 947731293 2:232433034-232433056 CCTAGGGGCAGGGAGCAGACCAG No data
Right 947731299 2:232433054-232433076 CAGGGGAAAGGCTCTGTCCCTGG No data
947731292_947731299 5 Left 947731292 2:232433026-232433048 CCTCAGGGCCTAGGGGCAGGGAG No data
Right 947731299 2:232433054-232433076 CAGGGGAAAGGCTCTGTCCCTGG No data
947731289_947731299 9 Left 947731289 2:232433022-232433044 CCAGCCTCAGGGCCTAGGGGCAG No data
Right 947731299 2:232433054-232433076 CAGGGGAAAGGCTCTGTCCCTGG No data
947731282_947731299 22 Left 947731282 2:232433009-232433031 CCTGTGCCTGTGACCAGCCTCAG No data
Right 947731299 2:232433054-232433076 CAGGGGAAAGGCTCTGTCCCTGG No data
947731285_947731299 16 Left 947731285 2:232433015-232433037 CCTGTGACCAGCCTCAGGGCCTA No data
Right 947731299 2:232433054-232433076 CAGGGGAAAGGCTCTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731299 Original CRISPR CAGGGGAAAGGCTCTGTCCC TGG Intergenic
No off target data available for this crispr