ID: 947731312

View in Genome Browser
Species Human (GRCh38)
Location 2:232433084-232433106
Sequence AACCTGGCTCTCCACCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731312_947731321 24 Left 947731312 2:232433084-232433106 CCGGGCAGGTGGAGAGCCAGGTT No data
Right 947731321 2:232433131-232433153 AGCTGCTGTGATCCTGGCAGAGG No data
947731312_947731320 18 Left 947731312 2:232433084-232433106 CCGGGCAGGTGGAGAGCCAGGTT No data
Right 947731320 2:232433125-232433147 CTCTGCAGCTGCTGTGATCCTGG No data
947731312_947731323 26 Left 947731312 2:232433084-232433106 CCGGGCAGGTGGAGAGCCAGGTT No data
Right 947731323 2:232433133-232433155 CTGCTGTGATCCTGGCAGAGGGG No data
947731312_947731322 25 Left 947731312 2:232433084-232433106 CCGGGCAGGTGGAGAGCCAGGTT No data
Right 947731322 2:232433132-232433154 GCTGCTGTGATCCTGGCAGAGGG No data
947731312_947731316 -6 Left 947731312 2:232433084-232433106 CCGGGCAGGTGGAGAGCCAGGTT No data
Right 947731316 2:232433101-232433123 CAGGTTCAGATGGGTGACCCTGG No data
947731312_947731324 29 Left 947731312 2:232433084-232433106 CCGGGCAGGTGGAGAGCCAGGTT No data
Right 947731324 2:232433136-232433158 CTGTGATCCTGGCAGAGGGGAGG No data
947731312_947731317 -5 Left 947731312 2:232433084-232433106 CCGGGCAGGTGGAGAGCCAGGTT No data
Right 947731317 2:232433102-232433124 AGGTTCAGATGGGTGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731312 Original CRISPR AACCTGGCTCTCCACCTGCC CGG (reversed) Intergenic
No off target data available for this crispr