ID: 947731315

View in Genome Browser
Species Human (GRCh38)
Location 2:232433100-232433122
Sequence CAGGGTCACCCATCTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731315_947731320 2 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731320 2:232433125-232433147 CTCTGCAGCTGCTGTGATCCTGG No data
947731315_947731321 8 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731321 2:232433131-232433153 AGCTGCTGTGATCCTGGCAGAGG No data
947731315_947731324 13 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731324 2:232433136-232433158 CTGTGATCCTGGCAGAGGGGAGG No data
947731315_947731327 25 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731327 2:232433148-232433170 CAGAGGGGAGGAGGCGCCCTCGG No data
947731315_947731323 10 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731323 2:232433133-232433155 CTGCTGTGATCCTGGCAGAGGGG No data
947731315_947731325 16 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731325 2:232433139-232433161 TGATCCTGGCAGAGGGGAGGAGG No data
947731315_947731322 9 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731322 2:232433132-232433154 GCTGCTGTGATCCTGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731315 Original CRISPR CAGGGTCACCCATCTGAACC TGG (reversed) Intergenic
No off target data available for this crispr