ID: 947731318

View in Genome Browser
Species Human (GRCh38)
Location 2:232433118-232433140
Sequence CACAGCAGCTGCAGAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731318_947731323 -8 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731323 2:232433133-232433155 CTGCTGTGATCCTGGCAGAGGGG No data
947731318_947731329 21 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731329 2:232433162-232433184 CGCCCTCGGCAGTCAGGAGCAGG No data
947731318_947731325 -2 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731325 2:232433139-232433161 TGATCCTGGCAGAGGGGAGGAGG No data
947731318_947731328 15 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731328 2:232433156-232433178 AGGAGGCGCCCTCGGCAGTCAGG No data
947731318_947731324 -5 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731324 2:232433136-232433158 CTGTGATCCTGGCAGAGGGGAGG No data
947731318_947731321 -10 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731321 2:232433131-232433153 AGCTGCTGTGATCCTGGCAGAGG No data
947731318_947731327 7 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731327 2:232433148-232433170 CAGAGGGGAGGAGGCGCCCTCGG No data
947731318_947731322 -9 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731322 2:232433132-232433154 GCTGCTGTGATCCTGGCAGAGGG No data
947731318_947731332 28 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731332 2:232433169-232433191 GGCAGTCAGGAGCAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731318 Original CRISPR CACAGCAGCTGCAGAGCCCA GGG (reversed) Intergenic
No off target data available for this crispr