ID: 947731319

View in Genome Browser
Species Human (GRCh38)
Location 2:232433119-232433141
Sequence TCACAGCAGCTGCAGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731319_947731328 14 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731328 2:232433156-232433178 AGGAGGCGCCCTCGGCAGTCAGG No data
947731319_947731322 -10 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731322 2:232433132-232433154 GCTGCTGTGATCCTGGCAGAGGG No data
947731319_947731323 -9 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731323 2:232433133-232433155 CTGCTGTGATCCTGGCAGAGGGG No data
947731319_947731327 6 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731327 2:232433148-232433170 CAGAGGGGAGGAGGCGCCCTCGG No data
947731319_947731329 20 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731329 2:232433162-232433184 CGCCCTCGGCAGTCAGGAGCAGG No data
947731319_947731324 -6 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731324 2:232433136-232433158 CTGTGATCCTGGCAGAGGGGAGG No data
947731319_947731332 27 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731332 2:232433169-232433191 GGCAGTCAGGAGCAGGATGATGG No data
947731319_947731325 -3 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731325 2:232433139-232433161 TGATCCTGGCAGAGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731319 Original CRISPR TCACAGCAGCTGCAGAGCCC AGG (reversed) Intergenic
No off target data available for this crispr