ID: 947731320

View in Genome Browser
Species Human (GRCh38)
Location 2:232433125-232433147
Sequence CTCTGCAGCTGCTGTGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731309_947731320 30 Left 947731309 2:232433072-232433094 CCTGGGGGGTGGCCGGGCAGGTG No data
Right 947731320 2:232433125-232433147 CTCTGCAGCTGCTGTGATCCTGG No data
947731315_947731320 2 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731320 2:232433125-232433147 CTCTGCAGCTGCTGTGATCCTGG No data
947731312_947731320 18 Left 947731312 2:232433084-232433106 CCGGGCAGGTGGAGAGCCAGGTT No data
Right 947731320 2:232433125-232433147 CTCTGCAGCTGCTGTGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731320 Original CRISPR CTCTGCAGCTGCTGTGATCC TGG Intergenic
No off target data available for this crispr