ID: 947731321

View in Genome Browser
Species Human (GRCh38)
Location 2:232433131-232433153
Sequence AGCTGCTGTGATCCTGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731312_947731321 24 Left 947731312 2:232433084-232433106 CCGGGCAGGTGGAGAGCCAGGTT No data
Right 947731321 2:232433131-232433153 AGCTGCTGTGATCCTGGCAGAGG No data
947731318_947731321 -10 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731321 2:232433131-232433153 AGCTGCTGTGATCCTGGCAGAGG No data
947731315_947731321 8 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731321 2:232433131-232433153 AGCTGCTGTGATCCTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731321 Original CRISPR AGCTGCTGTGATCCTGGCAG AGG Intergenic
No off target data available for this crispr