ID: 947731323

View in Genome Browser
Species Human (GRCh38)
Location 2:232433133-232433155
Sequence CTGCTGTGATCCTGGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731315_947731323 10 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731323 2:232433133-232433155 CTGCTGTGATCCTGGCAGAGGGG No data
947731312_947731323 26 Left 947731312 2:232433084-232433106 CCGGGCAGGTGGAGAGCCAGGTT No data
Right 947731323 2:232433133-232433155 CTGCTGTGATCCTGGCAGAGGGG No data
947731319_947731323 -9 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731323 2:232433133-232433155 CTGCTGTGATCCTGGCAGAGGGG No data
947731318_947731323 -8 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731323 2:232433133-232433155 CTGCTGTGATCCTGGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731323 Original CRISPR CTGCTGTGATCCTGGCAGAG GGG Intergenic
No off target data available for this crispr