ID: 947731325

View in Genome Browser
Species Human (GRCh38)
Location 2:232433139-232433161
Sequence TGATCCTGGCAGAGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731318_947731325 -2 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731325 2:232433139-232433161 TGATCCTGGCAGAGGGGAGGAGG No data
947731315_947731325 16 Left 947731315 2:232433100-232433122 CCAGGTTCAGATGGGTGACCCTG No data
Right 947731325 2:232433139-232433161 TGATCCTGGCAGAGGGGAGGAGG No data
947731319_947731325 -3 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731325 2:232433139-232433161 TGATCCTGGCAGAGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731325 Original CRISPR TGATCCTGGCAGAGGGGAGG AGG Intergenic
No off target data available for this crispr