ID: 947731326

View in Genome Browser
Species Human (GRCh38)
Location 2:232433143-232433165
Sequence GGCGCCTCCTCCCCTCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731326_947731333 14 Left 947731326 2:232433143-232433165 CCTGGCAGAGGGGAGGAGGCGCC No data
Right 947731333 2:232433180-232433202 GCAGGATGATGGTAGTGACAAGG No data
947731326_947731334 25 Left 947731326 2:232433143-232433165 CCTGGCAGAGGGGAGGAGGCGCC No data
Right 947731334 2:232433191-232433213 GTAGTGACAAGGCCCTGCTGTGG No data
947731326_947731328 -10 Left 947731326 2:232433143-232433165 CCTGGCAGAGGGGAGGAGGCGCC No data
Right 947731328 2:232433156-232433178 AGGAGGCGCCCTCGGCAGTCAGG No data
947731326_947731329 -4 Left 947731326 2:232433143-232433165 CCTGGCAGAGGGGAGGAGGCGCC No data
Right 947731329 2:232433162-232433184 CGCCCTCGGCAGTCAGGAGCAGG No data
947731326_947731332 3 Left 947731326 2:232433143-232433165 CCTGGCAGAGGGGAGGAGGCGCC No data
Right 947731332 2:232433169-232433191 GGCAGTCAGGAGCAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731326 Original CRISPR GGCGCCTCCTCCCCTCTGCC AGG (reversed) Intergenic
No off target data available for this crispr