ID: 947731329

View in Genome Browser
Species Human (GRCh38)
Location 2:232433162-232433184
Sequence CGCCCTCGGCAGTCAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731326_947731329 -4 Left 947731326 2:232433143-232433165 CCTGGCAGAGGGGAGGAGGCGCC No data
Right 947731329 2:232433162-232433184 CGCCCTCGGCAGTCAGGAGCAGG No data
947731319_947731329 20 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731329 2:232433162-232433184 CGCCCTCGGCAGTCAGGAGCAGG No data
947731318_947731329 21 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731329 2:232433162-232433184 CGCCCTCGGCAGTCAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731329 Original CRISPR CGCCCTCGGCAGTCAGGAGC AGG Intergenic
No off target data available for this crispr