ID: 947731332

View in Genome Browser
Species Human (GRCh38)
Location 2:232433169-232433191
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731319_947731332 27 Left 947731319 2:232433119-232433141 CCTGGGCTCTGCAGCTGCTGTGA No data
Right 947731332 2:232433169-232433191 GGCAGTCAGGAGCAGGATGATGG No data
947731326_947731332 3 Left 947731326 2:232433143-232433165 CCTGGCAGAGGGGAGGAGGCGCC No data
Right 947731332 2:232433169-232433191 GGCAGTCAGGAGCAGGATGATGG No data
947731318_947731332 28 Left 947731318 2:232433118-232433140 CCCTGGGCTCTGCAGCTGCTGTG No data
Right 947731332 2:232433169-232433191 GGCAGTCAGGAGCAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type