ID: 947731333

View in Genome Browser
Species Human (GRCh38)
Location 2:232433180-232433202
Sequence GCAGGATGATGGTAGTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947731330_947731333 -7 Left 947731330 2:232433164-232433186 CCCTCGGCAGTCAGGAGCAGGAT No data
Right 947731333 2:232433180-232433202 GCAGGATGATGGTAGTGACAAGG No data
947731326_947731333 14 Left 947731326 2:232433143-232433165 CCTGGCAGAGGGGAGGAGGCGCC No data
Right 947731333 2:232433180-232433202 GCAGGATGATGGTAGTGACAAGG No data
947731331_947731333 -8 Left 947731331 2:232433165-232433187 CCTCGGCAGTCAGGAGCAGGATG No data
Right 947731333 2:232433180-232433202 GCAGGATGATGGTAGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947731333 Original CRISPR GCAGGATGATGGTAGTGACA AGG Intergenic