ID: 947734293

View in Genome Browser
Species Human (GRCh38)
Location 2:232446734-232446756
Sequence CAGGGGACACAGAAGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947734293_947734304 5 Left 947734293 2:232446734-232446756 CCTGCCCTCTTCTGTGTCCCCTG No data
Right 947734304 2:232446762-232446784 CCCCAGCACTGCATCCTCCCGGG No data
947734293_947734302 4 Left 947734293 2:232446734-232446756 CCTGCCCTCTTCTGTGTCCCCTG No data
Right 947734302 2:232446761-232446783 CCCCCAGCACTGCATCCTCCCGG No data
947734293_947734307 9 Left 947734293 2:232446734-232446756 CCTGCCCTCTTCTGTGTCCCCTG No data
Right 947734307 2:232446766-232446788 AGCACTGCATCCTCCCGGGTAGG No data
947734293_947734308 10 Left 947734293 2:232446734-232446756 CCTGCCCTCTTCTGTGTCCCCTG No data
Right 947734308 2:232446767-232446789 GCACTGCATCCTCCCGGGTAGGG No data
947734293_947734309 17 Left 947734293 2:232446734-232446756 CCTGCCCTCTTCTGTGTCCCCTG No data
Right 947734309 2:232446774-232446796 ATCCTCCCGGGTAGGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947734293 Original CRISPR CAGGGGACACAGAAGAGGGC AGG (reversed) Intergenic
No off target data available for this crispr