ID: 947734737

View in Genome Browser
Species Human (GRCh38)
Location 2:232448731-232448753
Sequence ATGGGGTGACCGTGGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947734737_947734749 23 Left 947734737 2:232448731-232448753 CCCAGAGGCCACGGTCACCCCAT No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734737_947734744 6 Left 947734737 2:232448731-232448753 CCCAGAGGCCACGGTCACCCCAT No data
Right 947734744 2:232448760-232448782 CTGTCCCCAGAACCTTCTCCTGG No data
947734737_947734751 24 Left 947734737 2:232448731-232448753 CCCAGAGGCCACGGTCACCCCAT No data
Right 947734751 2:232448778-232448800 CCTGGAGCCAAGTATCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947734737 Original CRISPR ATGGGGTGACCGTGGCCTCT GGG (reversed) Intergenic
No off target data available for this crispr