ID: 947734738

View in Genome Browser
Species Human (GRCh38)
Location 2:232448732-232448754
Sequence GATGGGGTGACCGTGGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947734738_947734749 22 Left 947734738 2:232448732-232448754 CCAGAGGCCACGGTCACCCCATC No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734738_947734751 23 Left 947734738 2:232448732-232448754 CCAGAGGCCACGGTCACCCCATC No data
Right 947734751 2:232448778-232448800 CCTGGAGCCAAGTATCTGCAGGG No data
947734738_947734744 5 Left 947734738 2:232448732-232448754 CCAGAGGCCACGGTCACCCCATC No data
Right 947734744 2:232448760-232448782 CTGTCCCCAGAACCTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947734738 Original CRISPR GATGGGGTGACCGTGGCCTC TGG (reversed) Intergenic
No off target data available for this crispr