ID: 947734739

View in Genome Browser
Species Human (GRCh38)
Location 2:232448739-232448761
Sequence AGGAACAGATGGGGTGACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947734739_947734749 15 Left 947734739 2:232448739-232448761 CCACGGTCACCCCATCTGTTCCT No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734739_947734744 -2 Left 947734739 2:232448739-232448761 CCACGGTCACCCCATCTGTTCCT No data
Right 947734744 2:232448760-232448782 CTGTCCCCAGAACCTTCTCCTGG No data
947734739_947734751 16 Left 947734739 2:232448739-232448761 CCACGGTCACCCCATCTGTTCCT No data
Right 947734751 2:232448778-232448800 CCTGGAGCCAAGTATCTGCAGGG No data
947734739_947734753 25 Left 947734739 2:232448739-232448761 CCACGGTCACCCCATCTGTTCCT No data
Right 947734753 2:232448787-232448809 AAGTATCTGCAGGGACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947734739 Original CRISPR AGGAACAGATGGGGTGACCG TGG (reversed) Intergenic
No off target data available for this crispr