ID: 947734740

View in Genome Browser
Species Human (GRCh38)
Location 2:232448748-232448770
Sequence TCTGGGGACAGGAACAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947734740_947734755 28 Left 947734740 2:232448748-232448770 CCCCATCTGTTCCTGTCCCCAGA No data
Right 947734755 2:232448799-232448821 GGACAGACAGGCGAGCATCTGGG No data
947734740_947734754 27 Left 947734740 2:232448748-232448770 CCCCATCTGTTCCTGTCCCCAGA No data
Right 947734754 2:232448798-232448820 GGGACAGACAGGCGAGCATCTGG No data
947734740_947734756 29 Left 947734740 2:232448748-232448770 CCCCATCTGTTCCTGTCCCCAGA No data
Right 947734756 2:232448800-232448822 GACAGACAGGCGAGCATCTGGGG No data
947734740_947734753 16 Left 947734740 2:232448748-232448770 CCCCATCTGTTCCTGTCCCCAGA No data
Right 947734753 2:232448787-232448809 AAGTATCTGCAGGGACAGACAGG No data
947734740_947734751 7 Left 947734740 2:232448748-232448770 CCCCATCTGTTCCTGTCCCCAGA No data
Right 947734751 2:232448778-232448800 CCTGGAGCCAAGTATCTGCAGGG No data
947734740_947734757 30 Left 947734740 2:232448748-232448770 CCCCATCTGTTCCTGTCCCCAGA No data
Right 947734757 2:232448801-232448823 ACAGACAGGCGAGCATCTGGGGG No data
947734740_947734749 6 Left 947734740 2:232448748-232448770 CCCCATCTGTTCCTGTCCCCAGA No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947734740 Original CRISPR TCTGGGGACAGGAACAGATG GGG (reversed) Intergenic
No off target data available for this crispr