ID: 947734742

View in Genome Browser
Species Human (GRCh38)
Location 2:232448750-232448772
Sequence GTTCTGGGGACAGGAACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947734742_947734755 26 Left 947734742 2:232448750-232448772 CCATCTGTTCCTGTCCCCAGAAC No data
Right 947734755 2:232448799-232448821 GGACAGACAGGCGAGCATCTGGG No data
947734742_947734751 5 Left 947734742 2:232448750-232448772 CCATCTGTTCCTGTCCCCAGAAC No data
Right 947734751 2:232448778-232448800 CCTGGAGCCAAGTATCTGCAGGG No data
947734742_947734756 27 Left 947734742 2:232448750-232448772 CCATCTGTTCCTGTCCCCAGAAC No data
Right 947734756 2:232448800-232448822 GACAGACAGGCGAGCATCTGGGG No data
947734742_947734749 4 Left 947734742 2:232448750-232448772 CCATCTGTTCCTGTCCCCAGAAC No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734742_947734753 14 Left 947734742 2:232448750-232448772 CCATCTGTTCCTGTCCCCAGAAC No data
Right 947734753 2:232448787-232448809 AAGTATCTGCAGGGACAGACAGG No data
947734742_947734757 28 Left 947734742 2:232448750-232448772 CCATCTGTTCCTGTCCCCAGAAC No data
Right 947734757 2:232448801-232448823 ACAGACAGGCGAGCATCTGGGGG No data
947734742_947734754 25 Left 947734742 2:232448750-232448772 CCATCTGTTCCTGTCCCCAGAAC No data
Right 947734754 2:232448798-232448820 GGGACAGACAGGCGAGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947734742 Original CRISPR GTTCTGGGGACAGGAACAGA TGG (reversed) Intergenic
No off target data available for this crispr