ID: 947734743

View in Genome Browser
Species Human (GRCh38)
Location 2:232448759-232448781
Sequence CAGGAGAAGGTTCTGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947734743_947734754 16 Left 947734743 2:232448759-232448781 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947734754 2:232448798-232448820 GGGACAGACAGGCGAGCATCTGG No data
947734743_947734756 18 Left 947734743 2:232448759-232448781 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947734756 2:232448800-232448822 GACAGACAGGCGAGCATCTGGGG No data
947734743_947734753 5 Left 947734743 2:232448759-232448781 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947734753 2:232448787-232448809 AAGTATCTGCAGGGACAGACAGG No data
947734743_947734755 17 Left 947734743 2:232448759-232448781 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947734755 2:232448799-232448821 GGACAGACAGGCGAGCATCTGGG No data
947734743_947734749 -5 Left 947734743 2:232448759-232448781 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734743_947734751 -4 Left 947734743 2:232448759-232448781 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947734751 2:232448778-232448800 CCTGGAGCCAAGTATCTGCAGGG No data
947734743_947734758 24 Left 947734743 2:232448759-232448781 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947734758 2:232448806-232448828 CAGGCGAGCATCTGGGGGTTTGG No data
947734743_947734759 30 Left 947734743 2:232448759-232448781 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947734759 2:232448812-232448834 AGCATCTGGGGGTTTGGTGTTGG No data
947734743_947734757 19 Left 947734743 2:232448759-232448781 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947734757 2:232448801-232448823 ACAGACAGGCGAGCATCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947734743 Original CRISPR CAGGAGAAGGTTCTGGGGAC AGG (reversed) Intergenic
No off target data available for this crispr