ID: 947734745

View in Genome Browser
Species Human (GRCh38)
Location 2:232448764-232448786
Sequence GGCTCCAGGAGAAGGTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947734745_947734762 30 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734762 2:232448817-232448839 CTGGGGGTTTGGTGTTGGGGTGG No data
947734745_947734759 25 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734759 2:232448812-232448834 AGCATCTGGGGGTTTGGTGTTGG No data
947734745_947734755 12 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734755 2:232448799-232448821 GGACAGACAGGCGAGCATCTGGG No data
947734745_947734757 14 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734757 2:232448801-232448823 ACAGACAGGCGAGCATCTGGGGG No data
947734745_947734760 26 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734760 2:232448813-232448835 GCATCTGGGGGTTTGGTGTTGGG No data
947734745_947734758 19 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734758 2:232448806-232448828 CAGGCGAGCATCTGGGGGTTTGG No data
947734745_947734754 11 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734754 2:232448798-232448820 GGGACAGACAGGCGAGCATCTGG No data
947734745_947734753 0 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734753 2:232448787-232448809 AAGTATCTGCAGGGACAGACAGG No data
947734745_947734751 -9 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734751 2:232448778-232448800 CCTGGAGCCAAGTATCTGCAGGG No data
947734745_947734749 -10 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734745_947734756 13 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734756 2:232448800-232448822 GACAGACAGGCGAGCATCTGGGG No data
947734745_947734761 27 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734761 2:232448814-232448836 CATCTGGGGGTTTGGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947734745 Original CRISPR GGCTCCAGGAGAAGGTTCTG GGG (reversed) Intergenic
No off target data available for this crispr