ID: 947734749

View in Genome Browser
Species Human (GRCh38)
Location 2:232448777-232448799
Sequence TCCTGGAGCCAAGTATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947734738_947734749 22 Left 947734738 2:232448732-232448754 CCAGAGGCCACGGTCACCCCATC No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734740_947734749 6 Left 947734740 2:232448748-232448770 CCCCATCTGTTCCTGTCCCCAGA No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734742_947734749 4 Left 947734742 2:232448750-232448772 CCATCTGTTCCTGTCCCCAGAAC No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734741_947734749 5 Left 947734741 2:232448749-232448771 CCCATCTGTTCCTGTCCCCAGAA No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734737_947734749 23 Left 947734737 2:232448731-232448753 CCCAGAGGCCACGGTCACCCCAT No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734739_947734749 15 Left 947734739 2:232448739-232448761 CCACGGTCACCCCATCTGTTCCT No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734745_947734749 -10 Left 947734745 2:232448764-232448786 CCCCAGAACCTTCTCCTGGAGCC No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data
947734743_947734749 -5 Left 947734743 2:232448759-232448781 CCTGTCCCCAGAACCTTCTCCTG No data
Right 947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947734749 Original CRISPR TCCTGGAGCCAAGTATCTGC AGG Intergenic
No off target data available for this crispr