ID: 947736256

View in Genome Browser
Species Human (GRCh38)
Location 2:232456976-232456998
Sequence CTGCACTCAAGCCGATGGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 2, 2: 0, 3: 5, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947736256_947736263 19 Left 947736256 2:232456976-232456998 CCAGACCATCGGCTTGAGTGCAG 0: 1
1: 2
2: 0
3: 5
4: 77
Right 947736263 2:232457018-232457040 CAACACGACACGCGGCAATGAGG 0: 1
1: 2
2: 0
3: 0
4: 19
947736256_947736261 11 Left 947736256 2:232456976-232456998 CCAGACCATCGGCTTGAGTGCAG 0: 1
1: 2
2: 0
3: 5
4: 77
Right 947736261 2:232457010-232457032 AACCAGTGCAACACGACACGCGG 0: 3
1: 0
2: 0
3: 2
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947736256 Original CRISPR CTGCACTCAAGCCGATGGTC TGG (reversed) Exonic
905715584 1:40146716-40146738 GTTCACTCAAGCCGGTGGTTGGG + Intergenic
908223407 1:62032119-62032141 CTGAAGTCAAGGCGTTGGTCAGG + Intronic
908556271 1:65259689-65259711 CTGCTCTCATGCTGCTGGTCTGG - Intronic
912131939 1:106614107-106614129 CTGCAATCAAGGCATTGGTCAGG - Intergenic
920199722 1:204252104-204252126 CTGCACTAGAGCCGAGGGTGGGG - Intronic
922005145 1:221522683-221522705 CCTCTCTCAAGCCGATGCTCAGG - Intergenic
1066519842 10:36205156-36205178 CTGCACTCCAGCCTAGGGACAGG - Intergenic
1069770236 10:70893830-70893852 CTGCACTGAAGCGGATGGGTGGG + Intergenic
1070628789 10:78069697-78069719 CTGCCCTCCCGCTGATGGTCTGG - Intergenic
1070773908 10:79099051-79099073 CTGCTCTCAAGCAGATGAGCTGG - Intronic
1071598909 10:86946771-86946793 CTGCACTCAAGCTCAGGGTGTGG + Intronic
1074971437 10:118542554-118542576 CTGGACTAAAGCCTATGGCCAGG - Intergenic
1075479609 10:122768543-122768565 TTGCAGTCAAGGAGATGGTCAGG - Intergenic
1080807159 11:35663649-35663671 CTCAAATCAAGCCCATGGTCCGG - Exonic
1084611816 11:70207988-70208010 CTGCTCTCAAGGCGCAGGTCAGG + Intergenic
1085293984 11:75420428-75420450 CTGCACTCAAGCCATTTGTCAGG + Intronic
1085620046 11:78031089-78031111 CTGCACTCCAGCCTAGAGTCTGG - Intronic
1087720094 11:101653308-101653330 CTACAGTCAAGCTGTTGGTCAGG - Intronic
1087811477 11:102613212-102613234 CTGCTCTGAAGCCCAGGGTCTGG + Intronic
1094255884 12:28425500-28425522 CAGCACACAAGTCGAGGGTCAGG - Intronic
1100692862 12:97057429-97057451 CTGCAATCAAAGGGATGGTCAGG - Intergenic
1105464928 13:20630951-20630973 CAGTACTCAAGCTTATGGTCGGG - Intronic
1105629169 13:22144085-22144107 TTGCACTCAAGCTGTTGGCCAGG - Intergenic
1107830895 13:44373448-44373470 CTGGACCCAAGGCGGTGGTCAGG - Intergenic
1110030702 13:70609152-70609174 ATGCCCTCAAGCAAATGGTCTGG + Intergenic
1111254747 13:85651702-85651724 CTGCGGTCAAGTCGTTGGTCAGG - Intergenic
1111445803 13:88345374-88345396 CCGCACTGGAGCCCATGGTCGGG + Intergenic
1119114486 14:72006615-72006637 TTGCAATCAAGCTGATGGCCAGG - Intronic
1121215800 14:92246763-92246785 CTGCAGTCAAGCTGTTGGTTGGG - Intergenic
1133945445 16:10344149-10344171 CTGCATTCAAGGTGTTGGTCGGG - Intronic
1135050998 16:19192943-19192965 CTGCACTTGAGCCAATGGGCTGG + Intronic
1140213637 16:72990180-72990202 CTGCACTCAGTCCGATGGAGGGG + Intronic
1144171290 17:12662242-12662264 CTGCACTCAAGGCGCTGGCTAGG - Intergenic
1144376705 17:14650138-14650160 CCACACTCAAGCCCATGGGCAGG - Intergenic
1144807190 17:17975915-17975937 CTGCATCCAAGTGGATGGTCAGG + Intronic
1146721047 17:35123699-35123721 CTGCACTCCAGCCAGGGGTCTGG + Intronic
1152680560 17:81665834-81665856 GTGCACTCAAGCACATGGTGGGG + Intronic
1157009803 18:43633454-43633476 CCACACTCAAGCCTATGGGCGGG - Intergenic
1157109369 18:44805733-44805755 CTGAGCTCAAGGCCATGGTCAGG - Intronic
1165560176 19:36672242-36672264 ATGCACTGTAGCCAATGGTCTGG + Intergenic
1168464850 19:56594418-56594440 CTGCAGTCCAGCCAATGGACTGG - Intergenic
927498411 2:23565652-23565674 CTGCACTCCAGTGGATGGTGGGG + Intronic
929556963 2:42931660-42931682 CTGCTCTCCAGCCTATGATCTGG + Intergenic
931801316 2:65760769-65760791 CTGCACTGTACCCGTTGGTCAGG + Intergenic
933812143 2:86039502-86039524 CTGCACCCAAACAGAAGGTCTGG - Intronic
942335927 2:174885529-174885551 CTGCACTCCAGCCTGAGGTCAGG - Intronic
947722755 2:232379590-232379612 CTGCACTCAAGCCAATGGTCTGG - Exonic
947727094 2:232407671-232407693 CTGCACTCAAGCCAATGGTCTGG - Exonic
947736256 2:232456976-232456998 CTGCACTCAAGCCGATGGTCTGG - Exonic
948053281 2:234993849-234993871 CTGCACCCAAGCTGATTTTCTGG - Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
1175483707 20:59329640-59329662 CTGAACTCAAGCCAGAGGTCAGG + Intergenic
1175902885 20:62366939-62366961 CTGCGCTCACCCGGATGGTCTGG + Exonic
1178177408 21:30118938-30118960 CTGCACTCCAGCCTATCGACAGG - Intergenic
1179875925 21:44267373-44267395 CTGCCCTCCAGCCCATGGTGCGG + Intergenic
1184437101 22:44485770-44485792 CTGGATTCAAGCTGATGGACAGG - Intergenic
1184791595 22:46703596-46703618 CTCCACTCAAGGCGATGCTGCGG + Intronic
949275654 3:2276901-2276923 CTGCACTCCAGCCAAGGGTTTGG + Intronic
949479427 3:4479343-4479365 CTGAACTCAAGCCTGGGGTCAGG + Intergenic
950718051 3:14863663-14863685 CTGCAATCTAGCCGATGGCAAGG + Intronic
953749002 3:45595470-45595492 CTACACTCAGGCCGATGCTGGGG - Exonic
955200221 3:56845206-56845228 CTGCAATCAAGGCGTTGGCCAGG - Intronic
955601527 3:60650413-60650435 CAGGACTAAAGCCGAGGGTCTGG + Intronic
968332302 3:197881407-197881429 CTGCACACGAGCAGATGGGCTGG + Intronic
977745532 4:100542429-100542451 CTGCACTGGGGCCAATGGTCTGG - Intronic
977926563 4:102706188-102706210 CTGCACTGAAGCCCAAGGACAGG + Intronic
981398158 4:144278955-144278977 CTGCAGTCAAGCTCATGGCCAGG - Intergenic
985760018 5:1743939-1743961 CTTCACAGAAGCTGATGGTCAGG + Intergenic
991625679 5:68598407-68598429 CAGGACTCAAGCTGATTGTCAGG + Intergenic
997457678 5:134029229-134029251 CTGCAATCAAGAGGTTGGTCAGG - Intergenic
998267378 5:140676438-140676460 CTGCACTCAATCCTCTGCTCTGG - Intronic
1000378838 5:160610416-160610438 TTGCACTCAAGCTGTTGGTCAGG - Intronic
1002695737 5:181087164-181087186 CTGACCTCAAGCCCATCGTCTGG - Intergenic
1003257305 6:4485777-4485799 CTGCAATCAAGGTGATGGTCAGG + Intergenic
1004250603 6:14020245-14020267 CTGCAGTCAAGCTGTTGGCCAGG + Intergenic
1024002696 7:45201506-45201528 CTGCACTCCAGTCCATGGTTGGG - Intergenic
1038610665 8:29057693-29057715 CTGCATTCCAGCCCATGGTCTGG + Intronic
1040013658 8:42682768-42682790 CTGCACTCCAGCCTAGGGTATGG + Intergenic
1048358420 8:133673344-133673366 CTGTAATCAATCCGATGGACTGG + Intergenic
1051166726 9:14270480-14270502 CTGATCTCAAGCCAATGGTCTGG - Intronic
1053327986 9:37174270-37174292 CTGCACTCCAGCCTCTAGTCTGG + Intronic
1185495775 X:553854-553876 CTGCACTCCAGCCTGAGGTCAGG - Intergenic
1185550372 X:979192-979214 CTGCACTCCAGCCTGAGGTCAGG + Intergenic
1190408022 X:50106871-50106893 CTGCAGTCAAGGTGTTGGTCAGG + Intergenic
1193615376 X:83681577-83681599 CTGCAATCAAGGTGCTGGTCAGG - Intergenic