ID: 947736541

View in Genome Browser
Species Human (GRCh38)
Location 2:232458161-232458183
Sequence AAGGCGGGGCGCGGCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1404
Summary {0: 1, 1: 0, 2: 11, 3: 157, 4: 1235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947736532_947736541 -6 Left 947736532 2:232458144-232458166 CCCCTGGGGAGTGGAGGAAGGCG 0: 1
1: 0
2: 2
3: 35
4: 354
Right 947736541 2:232458161-232458183 AAGGCGGGGCGCGGCAGGGCAGG 0: 1
1: 0
2: 11
3: 157
4: 1235
947736535_947736541 -8 Left 947736535 2:232458146-232458168 CCTGGGGAGTGGAGGAAGGCGGG 0: 1
1: 0
2: 3
3: 51
4: 626
Right 947736541 2:232458161-232458183 AAGGCGGGGCGCGGCAGGGCAGG 0: 1
1: 0
2: 11
3: 157
4: 1235
947736524_947736541 19 Left 947736524 2:232458119-232458141 CCTCTTTGTGGAGGGTGCGTGGT 0: 1
1: 2
2: 1
3: 6
4: 127
Right 947736541 2:232458161-232458183 AAGGCGGGGCGCGGCAGGGCAGG 0: 1
1: 0
2: 11
3: 157
4: 1235
947736533_947736541 -7 Left 947736533 2:232458145-232458167 CCCTGGGGAGTGGAGGAAGGCGG 0: 1
1: 0
2: 3
3: 46
4: 395
Right 947736541 2:232458161-232458183 AAGGCGGGGCGCGGCAGGGCAGG 0: 1
1: 0
2: 11
3: 157
4: 1235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947736541 Original CRISPR AAGGCGGGGCGCGGCAGGGC AGG Intronic