ID: 947738952

View in Genome Browser
Species Human (GRCh38)
Location 2:232476205-232476227
Sequence ATAATCAGTCCTGGGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947738945_947738952 13 Left 947738945 2:232476169-232476191 CCCAGAGCAGGCAGGGGGAAAGG No data
Right 947738952 2:232476205-232476227 ATAATCAGTCCTGGGAAAGTGGG No data
947738939_947738952 25 Left 947738939 2:232476157-232476179 CCTCTGGACAAGCCCAGAGCAGG No data
Right 947738952 2:232476205-232476227 ATAATCAGTCCTGGGAAAGTGGG No data
947738947_947738952 12 Left 947738947 2:232476170-232476192 CCAGAGCAGGCAGGGGGAAAGGG No data
Right 947738952 2:232476205-232476227 ATAATCAGTCCTGGGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947738952 Original CRISPR ATAATCAGTCCTGGGAAAGT GGG Intergenic