ID: 947739906

View in Genome Browser
Species Human (GRCh38)
Location 2:232480298-232480320
Sequence TCACCCCTGGTTGCTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947739906_947739920 27 Left 947739906 2:232480298-232480320 CCAGCCCCAGCAACCAGGGGTGA 0: 1
1: 0
2: 2
3: 34
4: 244
Right 947739920 2:232480348-232480370 CCCACCCCAAACACAAGGAGTGG 0: 1
1: 0
2: 4
3: 27
4: 268
947739906_947739918 22 Left 947739906 2:232480298-232480320 CCAGCCCCAGCAACCAGGGGTGA 0: 1
1: 0
2: 2
3: 34
4: 244
Right 947739918 2:232480343-232480365 CTGATCCCACCCCAAACACAAGG 0: 1
1: 0
2: 1
3: 56
4: 622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947739906 Original CRISPR TCACCCCTGGTTGCTGGGGC TGG (reversed) Intronic
900295948 1:1949672-1949694 AGATCACTGGTTGCTGGGGCAGG - Intronic
900397367 1:2458578-2458600 TGACCCCTGCTTCCTGGGCCTGG + Intronic
900707311 1:4088864-4088886 TCCTCCCTGGGTCCTGGGGCAGG + Intergenic
900787053 1:4655693-4655715 ACTTCCCGGGTTGCTGGGGCGGG - Intronic
900906635 1:5564108-5564130 TGAGCCCTGGATGCTGGGGCTGG - Intergenic
901889466 1:12250228-12250250 TGACCTCTGGGTGATGGGGCTGG - Intronic
902797565 1:18809276-18809298 TCAATCCTGGATGCTGGGGGTGG - Intergenic
903101479 1:21034853-21034875 GCACTCCTGGTGGCTGGGCCTGG + Intronic
906126350 1:43429335-43429357 TCTCCCCTGGTTGCTCAGGCTGG - Intronic
906239868 1:44236179-44236201 CCACCCCTGGGTGCCAGGGCAGG - Intronic
912528949 1:110306311-110306333 TCTCCCCTGGTGACTTGGGCTGG + Intergenic
914343038 1:146776456-146776478 TCATCCCTGGTTGCAGGGGTGGG - Intergenic
914463945 1:147909509-147909531 TCACCCATAGCTGCTGGGGTTGG - Intergenic
915316185 1:155030331-155030353 ACCTCCCTGGATGCTGGGGCAGG + Intronic
915499011 1:156301640-156301662 TCTCCCCTTGTGGCTGGGTCCGG - Intergenic
915586516 1:156846648-156846670 TCACCCCTGGCTCCTGGGTGCGG + Exonic
917578349 1:176348203-176348225 TCACCCCCTGTAGCTGGGGAGGG - Intergenic
922453540 1:225755930-225755952 TGGTCCCTGGATGCTGGGGCAGG - Intergenic
922730710 1:227947692-227947714 GCACCCGGGGTGGCTGGGGCCGG - Intronic
922764634 1:228150609-228150631 CCCCCCCGGGGTGCTGGGGCAGG + Intronic
923678817 1:236102672-236102694 CCACCCCAGGCTGCCGGGGCAGG - Intergenic
924939871 1:248805626-248805648 TAACCCCTTGTGGCAGGGGCAGG + Intergenic
1062812912 10:478951-478973 TTGCCCCTGGGTGCTGGGGAAGG - Intronic
1062848014 10:722727-722749 TCGCACCTGGTTGCTGCGTCAGG - Intergenic
1063886367 10:10583581-10583603 TCAGACCAGGTTGCCGGGGCAGG + Intergenic
1067299128 10:44993380-44993402 TGAGCCCTGGTTGCTGGCCCCGG + Exonic
1067548455 10:47214695-47214717 TCAGCCCTGGATGCTGGGCAGGG + Intergenic
1070273698 10:74983430-74983452 TCACCTCAGCTGGCTGGGGCTGG - Intronic
1070828759 10:79406098-79406120 TCTCCCCTGCGTGCTGGGGCTGG + Intronic
1071714232 10:88078997-88079019 TCACCCCTGATGGATGGGGCTGG - Intergenic
1073556598 10:104458800-104458822 AGACCCATGGTTGCTTGGGCTGG - Intergenic
1075105832 10:119539411-119539433 TCACCCCTGGGTGCAGCTGCAGG + Intronic
1075693625 10:124418390-124418412 GCACCCTTGGTTCCTGGGGTTGG - Intronic
1076360306 10:129883735-129883757 TCACTGGTGGTTGCTGGGGTGGG + Intronic
1077036890 11:499634-499656 TCTCCCCATGATGCTGGGGCTGG - Intronic
1077404802 11:2378075-2378097 CCGCCCCTGGATGGTGGGGCGGG + Intronic
1079729418 11:23921399-23921421 CCACCCCTGGCAGCTGTGGCTGG - Intergenic
1080448843 11:32362183-32362205 ACACCCCTGGTGGGAGGGGCTGG - Intergenic
1081059936 11:38461834-38461856 TCACCCCTAGTTGCTGCTGTGGG - Intergenic
1083134408 11:60658175-60658197 TCAGCACTGGTTGCAGGAGCAGG + Intergenic
1083310371 11:61780751-61780773 TCCCCCCAGGGGGCTGGGGCCGG - Exonic
1083338229 11:61940409-61940431 TCACCCTTGGTTGCCCAGGCTGG - Intergenic
1083548247 11:63564838-63564860 ACACCCCTGTTTCCTGGGGCAGG + Intergenic
1083652368 11:64210975-64210997 TCACCCATGGGTGCTTGGGGCGG - Intronic
1083777455 11:64901149-64901171 TGAGGCCAGGTTGCTGGGGCTGG - Intronic
1085650943 11:78268060-78268082 TCCCCACTGGTTGCTTGGGAAGG - Intronic
1086951889 11:92899102-92899124 TCACAACTTGTTGCTGGGGGTGG - Intergenic
1089116074 11:116096257-116096279 TCATCCCTCTTTCCTGGGGCAGG - Intergenic
1090381151 11:126328547-126328569 GCACCCTGGGTGGCTGGGGCAGG + Intronic
1090423214 11:126589840-126589862 TCATCCCTGCCTCCTGGGGCTGG + Intronic
1090859208 11:130638270-130638292 TCACCCCTCGCTGCTGGAGCCGG + Intergenic
1091308677 11:134557769-134557791 ACACCCCTGCTGGCTGGGGTGGG - Intergenic
1091551161 12:1535894-1535916 TCACCCTTGGGAGCGGGGGCTGG + Intronic
1091796648 12:3301127-3301149 TCACCACTGGGAACTGGGGCAGG - Intergenic
1092359814 12:7827138-7827160 TCTGCCCTGGTTGCTCCGGCTGG + Intronic
1092881568 12:12891337-12891359 TCACCCCTGGAAGCTGGGCGGGG - Exonic
1096672566 12:53209035-53209057 TAACCCCTGGTTGTGGGGGAAGG - Intergenic
1097069204 12:56342617-56342639 TCACTCCTGGAGGCTGGGGATGG - Intronic
1100468976 12:94873605-94873627 TCGCCCCGGGGTGCGGGGGCGGG - Intergenic
1100980247 12:100157583-100157605 TCACCCCCAGTTCTTGGGGCTGG + Intergenic
1104081743 12:125435485-125435507 GCAGTCCTGGATGCTGGGGCTGG - Intronic
1104256874 12:127146724-127146746 TCAGGCCCGGGTGCTGGGGCAGG - Intergenic
1104646420 12:130500985-130501007 TGACCCCTGGATGCTCGGGTGGG - Intronic
1107482553 13:40796682-40796704 TCACCTCTGCTTGGTGGGCCTGG + Intronic
1110211098 13:72974379-72974401 ACACCCGTGGTTGATAGGGCTGG - Intronic
1117861406 14:60095892-60095914 TCACACCTGGAAGCTGGGTCAGG + Intronic
1119765844 14:77187252-77187274 TCACCTCTTACTGCTGGGGCTGG + Intronic
1121234006 14:92379417-92379439 TCCTCCCTGGTTGCAGGGGTGGG + Intronic
1121719150 14:96097204-96097226 TCAGACATGGCTGCTGGGGCAGG + Intergenic
1122312174 14:100804293-100804315 TGACCCCTGGGTGCTGGCCCTGG + Intergenic
1122728733 14:103779090-103779112 TCTCCCCATGTTGCTGAGGCTGG - Intronic
1202889387 14_KI270722v1_random:141434-141456 TCTCACCTTGTTGCTGAGGCTGG + Intergenic
1125206153 15:37155501-37155523 ACACTCCTGGTAGCTGGGGATGG - Intergenic
1125312897 15:38399897-38399919 TGACTGATGGTTGCTGGGGCGGG - Intergenic
1125499612 15:40231243-40231265 TCACCCCTAAGGGCTGGGGCTGG + Intergenic
1127282966 15:57507690-57507712 TCACCTCTGGATGCTGTGGCAGG + Intronic
1129476200 15:75785985-75786007 TCACCCCCAGTCCCTGGGGCTGG - Intergenic
1129891633 15:79075504-79075526 TCCCCTCTGGAAGCTGGGGCTGG + Intronic
1130485207 15:84394920-84394942 TCACCCCCAGTCTCTGGGGCTGG - Intergenic
1131156931 15:90081251-90081273 TCATCTCTGGTTCCAGGGGCAGG - Exonic
1131188523 15:90294772-90294794 TCACCCCCAGTCCCTGGGGCTGG - Exonic
1132432439 15:101772621-101772643 TCACCCCCAGTCACTGGGGCTGG + Intergenic
1132471717 16:107680-107702 TCTCACCATGTTGCTGGGGCTGG + Intronic
1132573847 16:655927-655949 CCTCGCCTGGATGCTGGGGCGGG + Intronic
1132852955 16:2033064-2033086 TCAGCCCTGGGTCCTGGGGCAGG + Intronic
1132877786 16:2148127-2148149 ACACACCAGGCTGCTGGGGCAGG - Intronic
1133071336 16:3248714-3248736 TGACCCCTGCCTGCTGGGGGTGG + Intronic
1134243096 16:12520221-12520243 TGACACCTGGGTGCAGGGGCAGG - Intronic
1134829724 16:17313297-17313319 AGGCCCCTGGCTGCTGGGGCTGG + Intronic
1138346739 16:56324764-56324786 TGACCCTTGGATGCTGGGTCAGG + Intronic
1139633443 16:68244519-68244541 TCGCCCCTGCTTCCTGGCGCAGG + Intergenic
1139659335 16:68410193-68410215 TGCCCCGTGGGTGCTGGGGCTGG + Intronic
1139990948 16:70938872-70938894 TCATCCCTGATTGCAGGGGTGGG + Intronic
1140900063 16:79358939-79358961 CCACCCCTGGCTGCTTGGGAAGG + Intergenic
1141300776 16:82813628-82813650 AGACCCCAGATTGCTGGGGCTGG + Intronic
1141462327 16:84184847-84184869 TCACCTCTGAGTTCTGGGGCTGG + Exonic
1141652913 16:85403077-85403099 TCTCCCATGGTTGCTGGGGGGGG + Intergenic
1141828853 16:86498509-86498531 TCTCCCCTCCTGGCTGGGGCGGG + Intergenic
1142084642 16:88170452-88170474 AGAGCCGTGGTTGCTGGGGCTGG - Intergenic
1142286209 16:89172505-89172527 TCACCCCAGGCAGCTGCGGCAGG - Intronic
1143022957 17:3926112-3926134 TCAGCCCTGGGGGCTGGGGGCGG - Intronic
1143100201 17:4500370-4500392 CCACCCCTAATTGCTGGGGAAGG - Intronic
1144623737 17:16833917-16833939 TCACACCTGGCTGCAGTGGCAGG - Intergenic
1145149541 17:20505587-20505609 TCACACCTGGCTGCAGTGGCAGG - Intergenic
1146918501 17:36693966-36693988 TCACTCTTTGTTGCTGAGGCTGG + Intergenic
1147188782 17:38726821-38726843 GCTCCCCTGGTTGGTGGGGGTGG - Exonic
1147651007 17:42062071-42062093 TTACCCCTGGCTCCTGGGGGAGG - Intronic
1148068314 17:44890035-44890057 TCACTCTTGTTTGCCGGGGCTGG + Intronic
1148460520 17:47836859-47836881 GCACCCCAGGTAGCAGGGGCAGG - Exonic
1149003023 17:51776343-51776365 TCTCACCTCGTTGCTGAGGCTGG - Intronic
1149581618 17:57754605-57754627 TCACCCAGGGTTACTGGGCCAGG - Intergenic
1150533718 17:66013740-66013762 TCACCCTTGTTAGCTGGGGTGGG + Intronic
1151324122 17:73368401-73368423 TCCCACCTGCTTGCTGGGTCTGG + Exonic
1151556823 17:74850859-74850881 TCACCTAGGGATGCTGGGGCAGG + Intronic
1152640278 17:81446442-81446464 ACAACCCTGGCTGCCGGGGCTGG - Intronic
1153225424 18:2896203-2896225 TCTCCCTTTGTTGCTGGGGCTGG + Intronic
1153675174 18:7450778-7450800 ACACCCCTGGATGATGGGCCAGG + Intergenic
1155152715 18:23135584-23135606 TCGCCCCTCGGTGCTGGGGATGG - Intronic
1158640948 18:59203069-59203091 TCCCCGCTCCTTGCTGGGGCTGG + Intergenic
1160618211 18:80150142-80150164 TCACCTCAGGGTGCTGGTGCAGG - Intronic
1160957622 19:1700656-1700678 TCGTCCTTGGTTGCTGCGGCTGG - Intergenic
1161422979 19:4185823-4185845 TCACCCCTGGCTCCATGGGCTGG - Intronic
1161792511 19:6368780-6368802 TCACCCCTTGTTGCTGGGCTTGG + Exonic
1161809617 19:6464481-6464503 TGACCTCTGGCGGCTGGGGCGGG + Intronic
1162327515 19:10007679-10007701 TCACCACGGGGAGCTGGGGCGGG + Intronic
1163263368 19:16204422-16204444 TCCCCCATGGCTGCTGGAGCTGG - Intronic
1165142781 19:33712425-33712447 TGACCCCTGGTTGCTGTGGGAGG + Intronic
1165695082 19:37894844-37894866 TCACTCCTGATTGATGGGCCTGG + Exonic
1166373700 19:42315672-42315694 GGACCCCTGGTTCCTGGGGGAGG + Intronic
1166581144 19:43901159-43901181 TCACAGCAGGTTCCTGGGGCTGG + Intronic
1166950167 19:46421942-46421964 GGACCCCTGGCTGATGGGGCAGG - Intergenic
1167440171 19:49503762-49503784 TCTCCCTTTGTTGCTCGGGCTGG - Intergenic
1167691108 19:50983963-50983985 GCACCCCAGGGCGCTGGGGCCGG - Intronic
1168035483 19:53716010-53716032 TTACACCATGTTGCTGGGGCTGG + Intergenic
925259803 2:2519611-2519633 TCACCCTTGGCTGGTGGTGCTGG - Intergenic
928317674 2:30258593-30258615 GTACCCATGGCTGCTGGGGCTGG - Exonic
929630323 2:43453515-43453537 TAACCTCTGGCTCCTGGGGCTGG + Intronic
931458002 2:62427042-62427064 TCATCCGTGGTCGATGGGGCTGG + Intergenic
931579154 2:63754106-63754128 TCATCCCTGGTGGCAAGGGCTGG + Intronic
931776926 2:65548919-65548941 TCACCTCTGGTAACTGGGACTGG + Intergenic
934704080 2:96464161-96464183 TCAACCCTGGTTCCTCGGCCTGG - Intergenic
935059191 2:99593296-99593318 ATACCCCTGGCTCCTGGGGCAGG + Exonic
935225265 2:101047219-101047241 TCACCCTCGGTTGATTGGGCTGG - Intronic
941688939 2:168478325-168478347 CCACCCCTCTCTGCTGGGGCTGG + Intronic
941893166 2:170603144-170603166 TCACCACTGATTTCAGGGGCAGG - Intronic
942519082 2:176784088-176784110 TCTCCTCTGGGTTCTGGGGCTGG - Intergenic
944207379 2:197170877-197170899 TCTCCCCTAGTTGATGGGGCCGG + Intronic
945953306 2:216061094-216061116 TCTCCCCTTGTTGCCGAGGCTGG - Intronic
946617701 2:221527560-221527582 ACCTCCCCGGTTGCTGGGGCTGG - Intronic
947122902 2:226835993-226836015 GCGCCCCGGGTTCCTGGGGCCGG - Exonic
947489337 2:230580424-230580446 TCACCCATCATTCCTGGGGCAGG - Intergenic
947739906 2:232480298-232480320 TCACCCCTGGTTGCTGGGGCTGG - Intronic
948685373 2:239666532-239666554 ACACACCTGGGTGATGGGGCCGG + Intergenic
948702603 2:239769707-239769729 ACACCCCTGCCAGCTGGGGCTGG + Intronic
1169311226 20:4541903-4541925 ACACCACAGGTGGCTGGGGCAGG + Intergenic
1169539110 20:6580778-6580800 TCACTCCTGGCTGCTGGGCCTGG - Intergenic
1169864119 20:10181751-10181773 TCACCTTTGGTTACTGGGGTGGG - Intergenic
1170087059 20:12545279-12545301 ACATCTCTGGTTGCTGGGGAAGG - Intergenic
1172839056 20:37891074-37891096 TGACCCCAGATTGCTGGGCCTGG - Intergenic
1173550592 20:43930595-43930617 TCACTCCCAGTTGCTTGGGCTGG + Intronic
1173864768 20:46307065-46307087 ACTCCCCAGGTTTCTGGGGCTGG - Intronic
1174611138 20:51800248-51800270 TCACACCTGGTGGGTGGGACGGG - Intronic
1175293874 20:57895663-57895685 TCACAGCTGGCAGCTGGGGCTGG - Intergenic
1175497272 20:59423662-59423684 TCACCCCTGTCAGCTGGGGTCGG - Intergenic
1178695691 21:34791850-34791872 CGTCCCCTGGGTGCTGGGGCCGG + Exonic
1179830090 21:43991316-43991338 TCACCCCTTTTTGCTGGGCTGGG + Intergenic
1180127482 21:45802247-45802269 TCACAGCTGGGTGCTGGGGCTGG + Intronic
1180221936 21:46364748-46364770 GCGGCCCTGGTTGCTGGGGAAGG - Intronic
1180875123 22:19171601-19171623 TCTCCCGTTGCTGCTGGGGCTGG - Intergenic
1180904807 22:19401972-19401994 GAACCCCTGGGAGCTGGGGCGGG - Intronic
1180970827 22:19814552-19814574 ACAACCCTGGTCACTGGGGCAGG - Intronic
1181992938 22:26851334-26851356 TTTCCCCTGGTTGGTGGGGCTGG + Intergenic
1182089447 22:27584024-27584046 GCACCCCTGGATCCTGGGGCTGG - Intergenic
1182422114 22:30253751-30253773 GCTCCCCTGGGTGCTGGGTCGGG - Intergenic
1182559819 22:31150812-31150834 GCACCCCTGGTGGCTGAGGTGGG + Intergenic
1183022789 22:35040535-35040557 TCACCACAGTTTGATGGGGCAGG - Intergenic
1183343993 22:37296796-37296818 ACACCCCTGGGTGCTGGGTGGGG - Intronic
1183408102 22:37640204-37640226 CCACCTCTGCTTGCTGGGCCGGG + Intronic
1184441402 22:44518802-44518824 TCACCCCTTGGTGCTGGACCTGG - Intergenic
1185038895 22:48494391-48494413 TCCACCCTGAATGCTGGGGCTGG - Intronic
950194162 3:10997387-10997409 GGCCCCCTGGCTGCTGGGGCTGG + Intronic
952884333 3:38003295-38003317 TTACCTCTTGTTGCTGGGGTAGG - Exonic
953570863 3:44070629-44070651 TCACCCCTACTTGCTGGGTCTGG - Intergenic
954615367 3:51966653-51966675 ACTCCCCTGGGTGCTGGGGCCGG + Intronic
956119729 3:65954381-65954403 TCGCTCCTGCTTGCCGGGGCTGG - Intronic
956748131 3:72325643-72325665 TCACTCCTGGTTCTGGGGGCTGG + Intergenic
957151411 3:76490987-76491009 TCACCCTGGGTTGCTCAGGCTGG + Intronic
960327671 3:116317118-116317140 TTACCTCTGGTGGCTGGGGATGG - Intronic
961419937 3:126795119-126795141 TCTGGCCTTGTTGCTGGGGCTGG + Intronic
963600033 3:147371164-147371186 TCACTCCAGGCTGCTGGCGCTGG - Intergenic
966523195 3:180895005-180895027 TCTCCTCTCCTTGCTGGGGCTGG + Intronic
968070087 3:195779350-195779372 TCACCTCTGGATGCTGAGGAAGG + Exonic
968098133 3:195946593-195946615 ACACCCCTGGTTACTGGGTTAGG + Intergenic
968604893 4:1530493-1530515 TCATCCCCTGGTGCTGGGGCTGG + Intergenic
968651068 4:1760533-1760555 TCACCCATGGTTGGTTGGGCTGG + Intergenic
968731408 4:2270974-2270996 CAACCCCTGGCAGCTGGGGCTGG - Intronic
969328545 4:6458843-6458865 TCACCTCTCATTGCTGGGGCTGG + Intronic
969487997 4:7482861-7482883 ACACCCCTGGCTGCTGTGGTGGG + Intronic
969526580 4:7706900-7706922 GCTCCCCTGGCTGCTGTGGCTGG + Intronic
971898788 4:32631940-32631962 TCACTCCTGCTTGCTGGGATTGG + Intergenic
972452868 4:39220915-39220937 TCTCCCTTTGTTGCTTGGGCTGG + Intronic
972739610 4:41877828-41877850 TCTCCCCTGGTAGCTGGGGTGGG - Intergenic
975690551 4:76958376-76958398 TCACCCCTGAGGGCTGAGGCTGG - Intronic
978327447 4:107575402-107575424 TCACGCCTAGATGCTGCGGCGGG + Intergenic
985692411 5:1320756-1320778 TGAACCCCAGTTGCTGGGGCTGG + Intronic
986105533 5:4656053-4656075 TCAGCCCTGGCTGCAGGGGCTGG + Intergenic
986713945 5:10509053-10509075 TCACCCCAGATCGCTGGAGCAGG + Exonic
990092160 5:52065262-52065284 GCACCCTTGATTACTGGGGCAGG - Intronic
994014389 5:94947814-94947836 TCTCCCTAGGTTGCTTGGGCTGG + Intronic
997263181 5:132479096-132479118 TGTCTCCTGGTTGGTGGGGCTGG - Intergenic
997488197 5:134249729-134249751 GCACTGCTGGTTGTTGGGGCTGG - Intergenic
998047940 5:139004966-139004988 TCGGGCCAGGTTGCTGGGGCAGG + Intronic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
999055777 5:148574690-148574712 CCACCACTACTTGCTGGGGCTGG + Intronic
999394470 5:151218342-151218364 TCTCCCCTGGTCACTGGGGACGG + Intronic
1000454814 5:161436812-161436834 GCATCTCTGGTTGCTGGGGAAGG + Intronic
1002981580 6:2143435-2143457 TCCCACCTGGATGCTGGGGCAGG - Intronic
1004752959 6:18582744-18582766 TCACTCCTGGGTGCTGGGGCTGG + Intergenic
1007746087 6:44043792-44043814 GCACCCCTTGTTGCGGGGGTGGG + Intergenic
1010453228 6:76026508-76026530 TCTCCCCTCCCTGCTGGGGCTGG + Intronic
1012611416 6:101225023-101225045 TCAGGCCTGGTTGGTGGTGCCGG + Intergenic
1017432816 6:154387206-154387228 TCACTCCTCCTTGCTGGTGCTGG + Intronic
1018856304 6:167677836-167677858 TCACCTCTTGCTGCTGGGGTTGG - Intergenic
1019434213 7:1013451-1013473 TCACCCCTGGCTGCTGCGCCAGG - Intronic
1019454939 7:1122105-1122127 TCACCCCTGGTTTCTGACTCTGG - Intronic
1019470832 7:1219712-1219734 ACACCCCTGGTGGCTGGGGCAGG + Intergenic
1019491516 7:1315927-1315949 TCACACCTGTTTCCTTGGGCAGG + Intergenic
1019968269 7:4519114-4519136 TCACCCCTGGCTGCATGGGAGGG - Intergenic
1021331054 7:19339706-19339728 TCCCCACTCGCTGCTGGGGCTGG + Intergenic
1022307778 7:29164667-29164689 GCATCCCTGGTGGCTGAGGCAGG + Intronic
1024540738 7:50473368-50473390 CCACTCCTGCTTCCTGGGGCTGG + Intronic
1024655252 7:51446559-51446581 TCTCCCCTCCCTGCTGGGGCTGG + Intergenic
1025107755 7:56186717-56186739 TTTCCCCAGGTTGCTGAGGCTGG - Intergenic
1026818866 7:73533218-73533240 TCTCCCTTTGTTGCTGAGGCTGG + Intergenic
1027181613 7:75944329-75944351 TCTCACCATGTTGCTGGGGCTGG - Intronic
1029707611 7:102284021-102284043 CCACCCCTGGGAGCTGGGGCTGG + Intergenic
1030055935 7:105583542-105583564 CAACCCCTGTTTGCTGGAGCTGG + Intronic
1031744625 7:125478380-125478402 TCTCCCCTTGTTGCTCAGGCTGG - Intergenic
1032455552 7:132070714-132070736 TCACCTCTGGTTACTTGGCCAGG + Intergenic
1033285839 7:140039978-140040000 ACAGCTCTGGTTGTTGGGGCCGG - Intronic
1036417118 8:8561256-8561278 TCATCCCTGGTTGCCAGGGCAGG - Intergenic
1036851511 8:12204995-12205017 TCTCCCTTTGTTGCTTGGGCTGG + Intergenic
1036872876 8:12447269-12447291 TCTCCCTTTGTTGCTTGGGCTGG + Intergenic
1038645398 8:29357273-29357295 GCACCCGTGGGTGCTCGGGCAGG - Intergenic
1039211494 8:35220316-35220338 TCAGCACTGGTTGCAAGGGCTGG + Intergenic
1042317130 8:67436074-67436096 GCTCCCCTGGTTGGTGGGGGTGG - Intronic
1042383969 8:68151537-68151559 TCACCCTTGGTTCCTGGACCTGG + Intronic
1044224188 8:89701091-89701113 TCACCAGTGGCTGCTGGGGAGGG - Intergenic
1044226204 8:89721614-89721636 TCACACCTGCCTTCTGGGGCAGG - Intergenic
1044374996 8:91459995-91460017 TCTCCTCTGGCTGGTGGGGCTGG + Intergenic
1044897572 8:96908910-96908932 TCACACTTGGGTGATGGGGCAGG - Intronic
1045673907 8:104588387-104588409 TAACCCCGGGTTGAGGGGGCGGG + Intronic
1047176997 8:122551220-122551242 TGTCCCCTGGATCCTGGGGCTGG - Intergenic
1049469029 8:142767143-142767165 TCACCCCTGGGTCCTGTGGGCGG + Intronic
1049580740 8:143409437-143409459 TAAACCCTGGCTCCTGGGGCTGG - Intergenic
1049855874 8:144861556-144861578 TCCCCCCTGGTTGTAGGGACAGG + Intergenic
1051359042 9:16265657-16265679 TCAGCCCTCATTGCTGGGGAGGG + Intronic
1052148360 9:25078769-25078791 TCTCCCTTTGTTGTTGGGGCTGG + Intergenic
1053468780 9:38330369-38330391 CAACCCCTGGTTGTTGGTGCTGG - Intergenic
1054970145 9:71076610-71076632 TCTCCCCTGATTTCTGGTGCAGG - Intronic
1055401707 9:75930896-75930918 ACACTCCTGGAGGCTGGGGCTGG + Intronic
1055718662 9:79146924-79146946 ACATCACTGGTTGCTGTGGCAGG + Intergenic
1056830886 9:89916424-89916446 TCACTCCTGATTGCGGGGGAGGG - Intergenic
1057054613 9:91950587-91950609 TCACCGCTGGTGTCTGGGGCTGG - Intergenic
1057846985 9:98533392-98533414 ACAAGCCTGGATGCTGGGGCTGG + Intronic
1059151047 9:111950007-111950029 TCACTCCTAGCTGCTGGAGCTGG - Intergenic
1060934475 9:127507259-127507281 TGACTCCGGGGTGCTGGGGCTGG + Exonic
1061062573 9:128258035-128258057 TCACCCCCGGTCCCTGGGGCTGG + Exonic
1062286261 9:135773874-135773896 GCACCCCCGGCTGGTGGGGCAGG - Intronic
1203769387 EBV:41125-41147 TCACCCCGGGGTGCTGGGGTGGG - Intergenic
1203789665 EBV:144044-144066 TCACCCCGGGGTGCTGGGGTGGG - Intergenic
1185768897 X:2749636-2749658 TCAGCCCTGCTGGCTGGGCCCGG - Intergenic
1186208915 X:7229769-7229791 TCACCCCTGGTAGCAGGAGTAGG - Intronic
1190062232 X:47218955-47218977 TCAGCCATGGTTGCTGGGCCCGG - Intronic
1190287296 X:48970172-48970194 TCACCCCCGGTGCCGGGGGCAGG + Exonic
1191645007 X:63470779-63470801 CCTCCCCTCCTTGCTGGGGCTGG - Intergenic
1192198085 X:69045784-69045806 TCACACCTGGAGTCTGGGGCCGG - Intergenic
1197374403 X:125664159-125664181 GCAGCCCTGGTGGCAGGGGCAGG - Intergenic
1199978025 X:152905758-152905780 TCACCCCTTGGTGCTGGTGCTGG + Intergenic
1202372908 Y:24210370-24210392 TCACCCCCAGTCTCTGGGGCTGG + Intergenic
1202497874 Y:25459750-25459772 TCACCCCCAGTCTCTGGGGCTGG - Intergenic