ID: 947741394

View in Genome Browser
Species Human (GRCh38)
Location 2:232486577-232486599
Sequence TACGTGAGCCGCTGCGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947741394_947741397 -10 Left 947741394 2:232486577-232486599 CCCGCGCCGCAGCGGCTCACGTA 0: 1
1: 0
2: 0
3: 4
4: 35
Right 947741397 2:232486590-232486612 GGCTCACGTACTTGACCTCTTGG 0: 1
1: 0
2: 1
3: 6
4: 66
947741394_947741402 25 Left 947741394 2:232486577-232486599 CCCGCGCCGCAGCGGCTCACGTA 0: 1
1: 0
2: 0
3: 4
4: 35
Right 947741402 2:232486625-232486647 TGCGCCGTCAGCGAATACGGGGG 0: 1
1: 0
2: 0
3: 0
4: 2
947741394_947741399 22 Left 947741394 2:232486577-232486599 CCCGCGCCGCAGCGGCTCACGTA 0: 1
1: 0
2: 0
3: 4
4: 35
Right 947741399 2:232486622-232486644 TAGTGCGCCGTCAGCGAATACGG 0: 1
1: 0
2: 0
3: 0
4: 9
947741394_947741400 23 Left 947741394 2:232486577-232486599 CCCGCGCCGCAGCGGCTCACGTA 0: 1
1: 0
2: 0
3: 4
4: 35
Right 947741400 2:232486623-232486645 AGTGCGCCGTCAGCGAATACGGG 0: 2
1: 1
2: 0
3: 1
4: 7
947741394_947741401 24 Left 947741394 2:232486577-232486599 CCCGCGCCGCAGCGGCTCACGTA 0: 1
1: 0
2: 0
3: 4
4: 35
Right 947741401 2:232486624-232486646 GTGCGCCGTCAGCGAATACGGGG 0: 1
1: 1
2: 2
3: 0
4: 4

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947741394 Original CRISPR TACGTGAGCCGCTGCGGCGC GGG (reversed) Exonic
911052366 1:93681687-93681709 TCCGGGAGCAGCCGCGGCGCGGG - Intronic
912533057 1:110340164-110340186 AAGGGGAGCGGCTGCGGCGCCGG - Exonic
919744609 1:201000550-201000572 CCCGTGAGAGGCTGCGGCGCAGG + Exonic
1073297719 10:102451026-102451048 CAGGTGAGCAGCTGCGGCGGCGG + Exonic
1076836316 10:133022857-133022879 TCCGTCAGCCGCGGCGGCTCTGG + Intergenic
1077073179 11:687093-687115 CACATGAGCCGCTGGGGCGCTGG - Intronic
1084171268 11:67401962-67401984 GACGTGAGGCGCGGCGGCCCGGG + Intronic
1096178674 12:49539115-49539137 CACGCGAGCCGCTGCCGCGGCGG + Intergenic
1096435869 12:51591001-51591023 TAGGTGGGCCGCGGGGGCGCGGG + Intronic
1100999617 12:100344558-100344580 TTCGGGAGCCGCTGTGGCTCAGG - Intergenic
1115490140 14:33950876-33950898 TACCCGAGCCGCTGCAGCGTCGG + Exonic
1122599986 14:102916475-102916497 TTCCTCAGCCTCTGCGGCGCCGG + Intergenic
1122886597 14:104713111-104713133 TCCCTGAGCCGCAGCAGCGCAGG - Intronic
1132390871 15:101437319-101437341 TAGGTGAGCCAGTGCTGCGCCGG - Intronic
1132779025 16:1612814-1612836 GACGCGAGCCGGTGCGGAGCGGG + Intronic
1139778196 16:69330281-69330303 TGCGTCAGCCGCTGCAGCTCGGG + Exonic
1142966685 17:3586096-3586118 TCCGTGAGCCGCGGCAGTGCTGG - Intronic
1147571163 17:41571943-41571965 TACTTGAGCCGCAGCGGCGGGGG - Exonic
1158579878 18:58671741-58671763 TGCGGGAGCCGCTGCTGCGGAGG + Exonic
942890517 2:180981087-180981109 TCCGCGAGCCGCGGCGGGGCCGG + Intronic
947724199 2:232387381-232387403 TATGTGAGTCACTGCGGCGCGGG - Intergenic
947729393 2:232419741-232419763 TACCTAAGCTGCTGTGGCGCGGG - Intergenic
947741394 2:232486577-232486599 TACGTGAGCCGCTGCGGCGCGGG - Exonic
1179992720 21:44957025-44957047 AAGGTGAGACGCTGCCGCGCAGG - Intronic
1180733810 22:18001198-18001220 GCCGGGAGCCGCCGCGGCGCGGG - Intronic
982281051 4:153684168-153684190 CACGTGCGCCGCTGCGCAGCCGG - Intergenic
989107899 5:37880589-37880611 TATGTGAGCTGCTGCTGCGCCGG + Intergenic
997292604 5:132748181-132748203 TGGGTGAGCCGCTGCGCCGGGGG + Intronic
998560764 5:143169642-143169664 TAAGTGAGCCTCTGTGGGGCTGG + Intronic
1022108040 7:27210729-27210751 GGCGTGAGCCGCTCCGACGCGGG - Intergenic
1026691510 7:72553947-72553969 GGCGTGAGCCACTGCGCCGCTGG + Intergenic
1029658504 7:101943479-101943501 GACGTCAGCCGCCGCCGCGCGGG - Intronic
1029701380 7:102248787-102248809 TACCTCAGCCGCCGCCGCGCCGG + Exonic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1039454399 8:37697670-37697692 GCCGTGAGCCGCGGCGGCGGTGG + Exonic
1044229539 8:89758127-89758149 TACCTGAGCCGCGGCGCCTCTGG + Exonic
1047203014 8:122782049-122782071 TTCGGGAGCCGCGGCGGCGACGG - Intronic
1048574897 8:135682628-135682650 TGGGTGAGCAGCTGCGGCTCTGG + Intergenic
1059102657 9:111484484-111484506 GTCGGGGGCCGCTGCGGCGCAGG - Exonic
1061840722 9:133357070-133357092 TAGGTGGTCCGCGGCGGCGCGGG + Intronic