ID: 947742567

View in Genome Browser
Species Human (GRCh38)
Location 2:232491287-232491309
Sequence CAGAGTAACCAGAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947742567_947742571 7 Left 947742567 2:232491287-232491309 CCCTCTTTCCTCTGGTTACTCTG No data
Right 947742571 2:232491317-232491339 TCCATTTCCCAGAACATGGCTGG No data
947742567_947742575 24 Left 947742567 2:232491287-232491309 CCCTCTTTCCTCTGGTTACTCTG No data
Right 947742575 2:232491334-232491356 GGCTGGCTCTGTCATCCCTCAGG No data
947742567_947742570 3 Left 947742567 2:232491287-232491309 CCCTCTTTCCTCTGGTTACTCTG No data
Right 947742570 2:232491313-232491335 TATTTCCATTTCCCAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947742567 Original CRISPR CAGAGTAACCAGAGGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr