ID: 947745184

View in Genome Browser
Species Human (GRCh38)
Location 2:232503594-232503616
Sequence AAAGAGGGGGACCCACCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947745184_947745190 -2 Left 947745184 2:232503594-232503616 CCTCGGGGTGGGTCCCCCTCTTT No data
Right 947745190 2:232503615-232503637 TTACCCTCGCTTCCCCCCGCGGG No data
947745184_947745198 13 Left 947745184 2:232503594-232503616 CCTCGGGGTGGGTCCCCCTCTTT No data
Right 947745198 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
947745184_947745201 30 Left 947745184 2:232503594-232503616 CCTCGGGGTGGGTCCCCCTCTTT No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745184_947745194 10 Left 947745184 2:232503594-232503616 CCTCGGGGTGGGTCCCCCTCTTT No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
947745184_947745189 -3 Left 947745184 2:232503594-232503616 CCTCGGGGTGGGTCCCCCTCTTT No data
Right 947745189 2:232503614-232503636 TTTACCCTCGCTTCCCCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947745184 Original CRISPR AAAGAGGGGGACCCACCCCG AGG (reversed) Intergenic