ID: 947745188

View in Genome Browser
Species Human (GRCh38)
Location 2:232503610-232503632
Sequence GGGGGGAAGCGAGGGTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947745188_947745194 -6 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
947745188_947745202 15 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745188_947745206 23 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745206 2:232503656-232503678 ATTCCCGAGCCCGGGGAGGGAGG No data
947745188_947745208 25 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745208 2:232503658-232503680 TCCCGAGCCCGGGGAGGGAGGGG No data
947745188_947745205 20 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745205 2:232503653-232503675 CTAATTCCCGAGCCCGGGGAGGG No data
947745188_947745207 24 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745207 2:232503657-232503679 TTCCCGAGCCCGGGGAGGGAGGG No data
947745188_947745198 -3 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745198 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
947745188_947745203 16 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745203 2:232503649-232503671 GCGGCTAATTCCCGAGCCCGGGG No data
947745188_947745210 26 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745210 2:232503659-232503681 CCCGAGCCCGGGGAGGGAGGGGG No data
947745188_947745204 19 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745204 2:232503652-232503674 GCTAATTCCCGAGCCCGGGGAGG No data
947745188_947745201 14 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947745188 Original CRISPR GGGGGGAAGCGAGGGTAAAG AGG (reversed) Intergenic
No off target data available for this crispr