ID: 947745194

View in Genome Browser
Species Human (GRCh38)
Location 2:232503627-232503649
Sequence CCCCCCGCGGGTGCCGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947745184_947745194 10 Left 947745184 2:232503594-232503616 CCTCGGGGTGGGTCCCCCTCTTT No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
947745181_947745194 16 Left 947745181 2:232503588-232503610 CCTGCCCCTCGGGGTGGGTCCCC No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
947745187_947745194 -5 Left 947745187 2:232503609-232503631 CCCTCTTTACCCTCGCTTCCCCC No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
947745186_947745194 -4 Left 947745186 2:232503608-232503630 CCCCTCTTTACCCTCGCTTCCCC No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
947745175_947745194 30 Left 947745175 2:232503574-232503596 CCTTTCTTTCTGCACCTGCCCCT No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
947745183_947745194 11 Left 947745183 2:232503593-232503615 CCCTCGGGGTGGGTCCCCCTCTT No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
947745185_947745194 -3 Left 947745185 2:232503607-232503629 CCCCCTCTTTACCCTCGCTTCCC No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
947745182_947745194 12 Left 947745182 2:232503592-232503614 CCCCTCGGGGTGGGTCCCCCTCT No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
947745188_947745194 -6 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745194 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947745194 Original CRISPR CCCCCCGCGGGTGCCGATAA AGG Intergenic