ID: 947745197

View in Genome Browser
Species Human (GRCh38)
Location 2:232503630-232503652
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947745197_947745201 -6 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745197_947745206 3 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745206 2:232503656-232503678 ATTCCCGAGCCCGGGGAGGGAGG No data
947745197_947745204 -1 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745204 2:232503652-232503674 GCTAATTCCCGAGCCCGGGGAGG No data
947745197_947745205 0 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745205 2:232503653-232503675 CTAATTCCCGAGCCCGGGGAGGG No data
947745197_947745208 5 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745208 2:232503658-232503680 TCCCGAGCCCGGGGAGGGAGGGG No data
947745197_947745207 4 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745207 2:232503657-232503679 TTCCCGAGCCCGGGGAGGGAGGG No data
947745197_947745202 -5 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745197_947745203 -4 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745203 2:232503649-232503671 GCGGCTAATTCCCGAGCCCGGGG No data
947745197_947745210 6 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745210 2:232503659-232503681 CCCGAGCCCGGGGAGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947745197 Original CRISPR CCGCCTTTATCGGCACCCGC GGG (reversed) Intergenic