ID: 947745200

View in Genome Browser
Species Human (GRCh38)
Location 2:232503640-232503662
Sequence CGGGAATTAGCCGCCTTTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947745200_947745208 -5 Left 947745200 2:232503640-232503662 CCGATAAAGGCGGCTAATTCCCG No data
Right 947745208 2:232503658-232503680 TCCCGAGCCCGGGGAGGGAGGGG No data
947745200_947745205 -10 Left 947745200 2:232503640-232503662 CCGATAAAGGCGGCTAATTCCCG No data
Right 947745205 2:232503653-232503675 CTAATTCCCGAGCCCGGGGAGGG No data
947745200_947745206 -7 Left 947745200 2:232503640-232503662 CCGATAAAGGCGGCTAATTCCCG No data
Right 947745206 2:232503656-232503678 ATTCCCGAGCCCGGGGAGGGAGG No data
947745200_947745210 -4 Left 947745200 2:232503640-232503662 CCGATAAAGGCGGCTAATTCCCG No data
Right 947745210 2:232503659-232503681 CCCGAGCCCGGGGAGGGAGGGGG No data
947745200_947745207 -6 Left 947745200 2:232503640-232503662 CCGATAAAGGCGGCTAATTCCCG No data
Right 947745207 2:232503657-232503679 TTCCCGAGCCCGGGGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947745200 Original CRISPR CGGGAATTAGCCGCCTTTAT CGG (reversed) Intergenic