ID: 947745201

View in Genome Browser
Species Human (GRCh38)
Location 2:232503647-232503669
Sequence AGGCGGCTAATTCCCGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947745195_947745201 -4 Left 947745195 2:232503628-232503650 CCCCCGCGGGTGCCGATAAAGGC No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745188_947745201 14 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745199_947745201 -7 Left 947745199 2:232503631-232503653 CCGCGGGTGCCGATAAAGGCGGC No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745196_947745201 -5 Left 947745196 2:232503629-232503651 CCCCGCGGGTGCCGATAAAGGCG No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745191_947745201 6 Left 947745191 2:232503618-232503640 CCCTCGCTTCCCCCCGCGGGTGC No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745193_947745201 -3 Left 947745193 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745187_947745201 15 Left 947745187 2:232503609-232503631 CCCTCTTTACCCTCGCTTCCCCC No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745197_947745201 -6 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745192_947745201 5 Left 947745192 2:232503619-232503641 CCTCGCTTCCCCCCGCGGGTGCC No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745184_947745201 30 Left 947745184 2:232503594-232503616 CCTCGGGGTGGGTCCCCCTCTTT No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745185_947745201 17 Left 947745185 2:232503607-232503629 CCCCCTCTTTACCCTCGCTTCCC No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data
947745186_947745201 16 Left 947745186 2:232503608-232503630 CCCCTCTTTACCCTCGCTTCCCC No data
Right 947745201 2:232503647-232503669 AGGCGGCTAATTCCCGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947745201 Original CRISPR AGGCGGCTAATTCCCGAGCC CGG Intergenic
No off target data available for this crispr