ID: 947745202

View in Genome Browser
Species Human (GRCh38)
Location 2:232503648-232503670
Sequence GGCGGCTAATTCCCGAGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947745195_947745202 -3 Left 947745195 2:232503628-232503650 CCCCCGCGGGTGCCGATAAAGGC No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745193_947745202 -2 Left 947745193 2:232503627-232503649 CCCCCCGCGGGTGCCGATAAAGG No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745187_947745202 16 Left 947745187 2:232503609-232503631 CCCTCTTTACCCTCGCTTCCCCC No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745199_947745202 -6 Left 947745199 2:232503631-232503653 CCGCGGGTGCCGATAAAGGCGGC No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745185_947745202 18 Left 947745185 2:232503607-232503629 CCCCCTCTTTACCCTCGCTTCCC No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745197_947745202 -5 Left 947745197 2:232503630-232503652 CCCGCGGGTGCCGATAAAGGCGG No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745186_947745202 17 Left 947745186 2:232503608-232503630 CCCCTCTTTACCCTCGCTTCCCC No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745191_947745202 7 Left 947745191 2:232503618-232503640 CCCTCGCTTCCCCCCGCGGGTGC No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745192_947745202 6 Left 947745192 2:232503619-232503641 CCTCGCTTCCCCCCGCGGGTGCC No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745188_947745202 15 Left 947745188 2:232503610-232503632 CCTCTTTACCCTCGCTTCCCCCC No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data
947745196_947745202 -4 Left 947745196 2:232503629-232503651 CCCCGCGGGTGCCGATAAAGGCG No data
Right 947745202 2:232503648-232503670 GGCGGCTAATTCCCGAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947745202 Original CRISPR GGCGGCTAATTCCCGAGCCC GGG Intergenic