ID: 947746257

View in Genome Browser
Species Human (GRCh38)
Location 2:232508762-232508784
Sequence CCAGAAAAGCTGACCGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947746257_947746273 30 Left 947746257 2:232508762-232508784 CCATCCACGGTCAGCTTTTCTGG No data
Right 947746273 2:232508815-232508837 TTGGCCTTAGTGTGGGCGGAGGG No data
947746257_947746270 26 Left 947746257 2:232508762-232508784 CCATCCACGGTCAGCTTTTCTGG No data
Right 947746270 2:232508811-232508833 GTCCTTGGCCTTAGTGTGGGCGG No data
947746257_947746269 23 Left 947746257 2:232508762-232508784 CCATCCACGGTCAGCTTTTCTGG No data
Right 947746269 2:232508808-232508830 CGAGTCCTTGGCCTTAGTGTGGG No data
947746257_947746262 11 Left 947746257 2:232508762-232508784 CCATCCACGGTCAGCTTTTCTGG No data
Right 947746262 2:232508796-232508818 GTCCCTACCCTCCGAGTCCTTGG No data
947746257_947746268 22 Left 947746257 2:232508762-232508784 CCATCCACGGTCAGCTTTTCTGG No data
Right 947746268 2:232508807-232508829 CCGAGTCCTTGGCCTTAGTGTGG No data
947746257_947746272 29 Left 947746257 2:232508762-232508784 CCATCCACGGTCAGCTTTTCTGG No data
Right 947746272 2:232508814-232508836 CTTGGCCTTAGTGTGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947746257 Original CRISPR CCAGAAAAGCTGACCGTGGA TGG (reversed) Intergenic
No off target data available for this crispr