ID: 947746791

View in Genome Browser
Species Human (GRCh38)
Location 2:232512088-232512110
Sequence CTCCTGTCCTTGGCCTAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947746783_947746791 18 Left 947746783 2:232512047-232512069 CCAATGCTAGCTGGCTAAAGGGG No data
Right 947746791 2:232512088-232512110 CTCCTGTCCTTGGCCTAAAACGG No data
947746779_947746791 23 Left 947746779 2:232512042-232512064 CCCTACCAATGCTAGCTGGCTAA No data
Right 947746791 2:232512088-232512110 CTCCTGTCCTTGGCCTAAAACGG No data
947746780_947746791 22 Left 947746780 2:232512043-232512065 CCTACCAATGCTAGCTGGCTAAA No data
Right 947746791 2:232512088-232512110 CTCCTGTCCTTGGCCTAAAACGG No data
947746778_947746791 24 Left 947746778 2:232512041-232512063 CCCCTACCAATGCTAGCTGGCTA No data
Right 947746791 2:232512088-232512110 CTCCTGTCCTTGGCCTAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947746791 Original CRISPR CTCCTGTCCTTGGCCTAAAA CGG Intergenic
No off target data available for this crispr