ID: 947746959

View in Genome Browser
Species Human (GRCh38)
Location 2:232512782-232512804
Sequence ACATACACACGCACACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947746959_947746964 26 Left 947746959 2:232512782-232512804 CCAGCATGTGTGCGTGTGTATGT No data
Right 947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG No data
947746959_947746966 30 Left 947746959 2:232512782-232512804 CCAGCATGTGTGCGTGTGTATGT No data
Right 947746966 2:232512835-232512857 GCGCACGTGTGTGCAGGGGAGGG No data
947746959_947746962 24 Left 947746959 2:232512782-232512804 CCAGCATGTGTGCGTGTGTATGT No data
Right 947746962 2:232512829-232512851 GTGCATGCGCACGTGTGTGCAGG No data
947746959_947746965 29 Left 947746959 2:232512782-232512804 CCAGCATGTGTGCGTGTGTATGT No data
Right 947746965 2:232512834-232512856 TGCGCACGTGTGTGCAGGGGAGG No data
947746959_947746963 25 Left 947746959 2:232512782-232512804 CCAGCATGTGTGCGTGTGTATGT No data
Right 947746963 2:232512830-232512852 TGCATGCGCACGTGTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947746959 Original CRISPR ACATACACACGCACACATGC TGG (reversed) Intergenic
No off target data available for this crispr