ID: 947746964

View in Genome Browser
Species Human (GRCh38)
Location 2:232512831-232512853
Sequence GCATGCGCACGTGTGTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947746959_947746964 26 Left 947746959 2:232512782-232512804 CCAGCATGTGTGCGTGTGTATGT No data
Right 947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947746964 Original CRISPR GCATGCGCACGTGTGTGCAG GGG Intergenic
No off target data available for this crispr